Skip to main content

Combining manipulation of integration loci and secretory pathway on expression of an Aspergillus niger glucose oxidase gene in Trichoderma reesei


Trichoderma reesei (T. reesei) is well-known for its excellent ability to secret a large quantity of cellulase. However, unlike the endogenous proteins, little is known about the molecular mechanisms governing heterologous protein production. Herein, we focused on the integration loci and the secretory pathway, and investigated their combinatorial effects on heterologous gene expression in T. reesei using a glucose oxidase from Aspergillus niger as a model protein. Integration in the cel3c locus was more efficient than the cbh1 locus in expressing the AnGOx by increasing the transcription of AnGOx in the early stage. In addition, we discovered that interruption of the cel3c locus has an additional effect by increasing the expression of the secretory pathway component genes. Accordingly, overexpressing three secretory pathway component genes, that were snc1, sso2, and rho3, increased AnGOx expression in the cbh1 transformant but not in the cel3c transformant.


Trichoderma reesei (T. reesei) is a well-known filamentous fungus work horse for large scale production of cellulase [1], which has been widely used in food, feed, textile, and biofuel industries. In addition, there is a long history of using T. reesei as a host to produce heterologous proteins from bacteria [2], fungi [3], and even mammals [4]. In making T. reesei an efficient microbial protein producer, one frequently observed phenomenon is that the initial production level of the heterologous protein is low. For example, eight proteins (including the bovine chymosin, Phlebia radiate laccase, Hormoconis resinae glucoamylase, Fab antibody fragment, barley endopeptidase B, Aspergillus niger acid phosphatase, and A. niger lipase) were produced in T. reesei to a yield not exceeding 1 g/L (20 ~ 700 mg/L) [5]. This indicates that the host strain and/or the genes of interest require sophisticated engineering toward an ultimately satisfying level of expression, given the fact that the endogenous cellulase can be produced at a level of up to over 100 g/L [1]. As cellulase is the prototype of secretory protein expression in T. reesei, the strategies used to improve heterologous gene expression can commonly be reused from those employed in improving cellulase production. Basically, one most applied strategy involves the use of a strong inducible cellulase promoter (in most cases the promoter of cbh1 encoding cellobiohydrolase I) to direct the transcription of the genes of interest [6].

In cellulase expression, transcription is generally regarded as the major regulatory stage [7]. However, a variety of factors including the selection marker [8], codon bias [3], mRNA stability [9], and other cellular activities including secretion, glycosylation, cell morphogenesis, protease-mediated intra- and extracellular protein degradation, mitochondrial status, and cell metabolism are all able to impact cellulase production. This, in turn, suggests that these regulatory stages can be engineered to improve cellulase production in T. reesei. Indeed, the plethora of knowledge has enabled successful improvement of cellulase production [10, 11]. The heterologous genes that can be functionally expressed in T. reesei are rapidly expanding in these years [3, 12,13,14,15,16]. Nevertheless, despite these achievements, little is known about whether altering the abovementioned cellular activities such as protein secretion would have effects on heterologous protein production in T. reesei. Moreover, much less is known about the effect of combinatorial manipulation of multiple expression-enhancing factors on heterologous protein production. The understanding of combinatorial manipulation is particularly important because strain improvement usually demands multiple and iterative rounds of genetic engineering.

The Aspergillus niger (A. niger) glucose oxidase (AnGOx) is an enzyme that converts glucose to gluconic acid with concurrent releasing of hydrogen peroxide. This biochemical reaction is of wide application value. For example, AnGOx is a widely used glucose sensor protein on a variety of chips [17]. In addition, the GOx-catalyzed production of gluconic acid is used in cement to enhance the intensity [18]. Recently, AnGOx was shown to be beneficial for growth performance of broiler chickens, making it an ideal candidate enzyme in the poultry industry [19]. Previously, we have codon-optimized the coding sequence of AnGOx, successfully expressed it in T. reesei, and discovered that overexpressing the key component genes (snc1, bip1, and hac1) in the secretion pathway could improve AnGOx secretion [20]. However, its production level (0.6 U/mL in shake flask fermentation) is still not satisfactory, restricting its use in these areas. This protein has a moderate molecular mass, can be expressed in T. reesei (albeit in minor amount), and additionally, has a FAD prosthetic group that needs to be correctly assembled. These collectively make AnGOx a perfect model to study the mechanisms directing heterologous gene expression in T. reesei. Herein, we used AnGOx as a model gene to investigate the effects of combining two factors, i.e. the loci of integration (cbh1 and cel3c) and overexpression of the secretory pathway genes (snc1, sso2, and rho3), on expression of a heterologous gene in T. reesei.

Results and discussion

Expression of AnGOx was highly influenced by the integration loci

As addressed above, many factors can have profound effects on expression of the heterologous genes. We decided to choose the integration loci and secretory pathway to investigate their individual and combinatorial effects on secretory protein expression (Fig. 1). The reason for choosing the integration loci is that the integration loci are well-known to have a large impact on gene expression, particularly affecting the stage of gene transcription. This is important as cellulase expression is mainly regulated at the transcription level in T. reesei [7]. The major, strong cellulase cbh1 promoter was employed in this study to drive AnGOx expression, suggesting that manipulation of the transcription stage could similarly have a significant effect on gene expression. Currently, there are no known self-replicating plasmids in T. reesei, indicating that all transformed DNA fragments are integrated into the chromosome. Correspondingly, the integration loci could largely affect gene expression, because the accessibility to transcription factors and RNA polymerase is not identical along the chromosomes [21].

Fig. 1
figure 1

A schematic diagram showing the effects of combining the integration loci and overexpression of selected component genes in the secretion pathway on expression of the A. niger glucose oxidase. The investigated integration loci were the cbh1 and cel3c sites, respectively, with the former being a commonly employed one and the latter recently discovered. Three genes, that were snc1, sso2, and rho3, were selected as representative component genes in the secretion pathway for investigation of the effects of their overexpression on secretive AnGOx expression. The snc1 encodes a v-SNARE protein, sso2 gene encodes a t-SNARE protein, and rho3 encodes a small GTPase involved in protein secretion

Random integration was used in our previous overexpression of AnGOx in T. reesei, raising the uncertainty to the final yield of AnGOx. Therefore, to minimize the uncertain effect of integration loci on gene expression, targeted integration of AnGOx into two genetic loci (cbh1 and cel3c) was employed. These two loci were either well-known (cbh1) or newly identified (cel3c, which encodes a β-glucosidase) [12], likely favoring heterologous gene expression. In T. reesei, cbh1 is the most favored locus because cbh1 is induced up to several thousand folds on the cellulose culture medium [7], suggesting that the chromosome of this locus must be in a less condensed state in the induction state. Although other loci favorable for protein production have been discovered, no report was available for a comparison of these different sites. Therefore, AnGOx was targeted to one of the two loci (cbh1 and cel3c) for heterologous expression in T. reesei. Correct integration of AnGOx using the DNA fragments amplified from pGOx_cbh1 and pGOx_cel3c (Fig. 2A) in these loci was verified by diagnostic PCR (Fig. 2B), as demonstrated by a 7.4-kbp and a 8.0-kbp DNA fragment in the AnGOx transformants targeting to cbh1 and cel3c, respectively. In contrast, the same primer pairs amplified 2.8-kbp and 1.9-kbp in the parental strain QM9414 (Fig. 2C). In addition, a single copy of AnGOx was detected in both strains as analyzed by quantitative PCR (data not shown).

Fig. 2
figure 2

The integration loci were important for expression of AnGOx in T. reesei. A: The plasmid maps of pGOx_cbh1 and pGOx_cel3c. B: Schematic diagram showing the DNA fragments that were amplified in diagnostic PCR verification of transformants with integration in the cbh1 and cel3c loci, respectively. The primer pairs used were cbh1-VF/VR and cel3c-VF/VR for integration in cbh1 and cel3c, respectively. C. PCR verification of targeted integration of the AnGOx-expressing cassette in the cbh1 and cel3c loci. The primer pair cbh1-VF/VR was used for lane 1 and 2, while the primer pair cel3c-VF/VR was used for lane 3 and 4. Lane 1: QM9414; 2: QM9414-cbh1; 3: QM9414-cel3c; 4: QM9414. M: DNA molecular mass marker. D: SDS-PAGE of the extracellular proteins of the T. reesei parent strain QM9414 and the cbh1- and cel3c-integrated AnGOx-expressing strains. Lane M: protein molecular mass marker; 1: QM9414; 2: QM9414-cbh1; 3:QM9414-cel3c. E: Time course analysis of the AnGOx activity in the supernatant of the cbh1 (QM9414-cbh1) and cel3c-integrated (QM9414-cel3c) AnGOx-expressing strains. F: Time course analysis of the AnGOx activity in the strains of QM9414-cel3c and QM9414-cel3c-cbh1 (with AnGOx integrated in both cbh1 and cel3c) strains

Interestingly, AnGOx was expressed to a higher level when integrated in the cel3c locus than that in the cbh1 site, as demonstrated by SDS-PAGE analysis and assay of the GOx activity. On day 7 post cellulose induction, AnGOx was expressed to a higher level, which could be easily visualized on the SDS-PAGE gel (Fig. 2D). The glucose oxidase activity was 309 U/mL in the cel3c-integrated site and 126 U/mL in the cbh1-integrated site (Fig. 2E). In T. reesei, CBH1 is the major extracellular protein, accounting to up to 60% of the total extracellular proteins. Integration at the cbh1 locus disrupted synthesis of the CBH1 protein, thereby likely releasing the secreting capacity of the cell available for other proteins such as the heterologous AnGOx. Therefore, the comparably lower expression for the cbh1-integrated expression was somewhat unexpected and suggested that there might be unveiled mechanisms governing the cel3c-integrated expression. Moreover, simultaneous integration of one copy of the AnGOx gene in the cbh1 and cel3c loci, respectively, did not increase its expression. On the contrary, the extracellular GOx activity reached to a level (160 U/mL) slightly higher than that obtained with integration to cbh1 (Fig. 2F).

AnGOx was transcribed at a higher level in the cel3c locus at the early stage of induction

The transcript level of AnGOx in the cbh1-integrated transformant was compared to that in the cel3c-integrated strain. RT-qPCR analysis of the two strains cultivated on cellulose-containing inducing medium indicated that the transcript level of AnGOx in the cel3c transformant was 5.0-fold higher than that in the cbh1 transformant at 24 h post induction (Fig. 3A). However, with the culture continuing, the difference between the AnGOx transcript levels in the two strains was diminished: the relative transcript level of AnGOx in the cel3c-integrated strain was 0.89-fold that of the cbh1-integrated strain at 48 h post induction (Fig. 3B). The cel3c transcript level is not high in T. reesei [22]. However, as the observations by us and other researchers were clearly suggestive of the ability of the cel3c locus to drive robust transcription, it was assumed that the cel3c gene transcript might have a short half-life [12]. In addition, because the cbh1 promoter used in this study is as long as 1.5-kb, the effect of the upstream sequence on AnGOx-expression may not be as significant as that described for a hybrid promoter (constructed by fusing core regions of the Pcdna1 and Pcbh1 [6]. There have been studies indicating that specific loci with a more open chromosome state are responsible for the more favorable heterologous gene expression [23]. This suggested that the cel3c locus in the chromosome might also have such an open state at the early stage of induction. However, it was also noticed that, while the difference of the transcription levels between the two strains was diminishing, the difference in the extracellular AnGOx enzyme level was growing larger. This strongly suggested that integration in the cel3c locus might have an additional regulatory role for expression of the heterologous AnGOx.

Fig. 3
figure 3

AnGOx was expressed at a higher level in the early stage of induction in QM9414-cel3c transformant as analyzed by RT-qPCR. A and B: comparison of the AnGOx expression in QM9414-cbh1 and QM9414-cel3c strains at 24 h (A) and 48 h B. The T. reesei cells were induced with cellulose. At 24 h and 48 h post induction, mycelia were collected. The total RNA was extracted from the mycelia and then reverse-transcribed to cDNA. In RT-qPCR analysis, the sar1 gene was used as the internal reference gene. For both the 2 time points, the transcript abundance of AnGOx in the QM9414-cbh1 was set as 1.0. The relative transcript level of AnGOx in the QM9414-cel3c was calculated through dividing by that in the QM9414-cbh1 strain. ns not significant; ****, P < 0.0001

The combinatorial effects of overexpressing component genes in the secretory pathway on AnGOx expression

In addition, another factor, i.e. the secretory pathway, was also selected for investigation solely or in combination with the integration loci. In many microbial organisms, overexpressing the heterologous genes is known to incur high burdens to many facets of the cellular activities [24,25,26]. One most frequently observed phenomenon is the competition of endogenous and heterologous proteins for the protein folding apparatuses, which can be alleviated by introducing extra copies of folding chaperones [27]. Heterologous gene expression can also impose a similarly heavy burden to the protein translocation process to the extracellular milieu, although this process is much less known in T. reesei. Specifically, AnGOx expression can be improved by overexpressing key component genes in the secretory pathway. Therefore, the integration loci and manipulation of the secretory pathway were selected as two representative factors to investigate their impacts on expression of AnGOx (Fig. 1).

The DNA fragments for overexpressing three different component genes (snc1, sso2, and rho3) amplified form the pPpdc1-snc1 (Fig. 4A), pPpdc1-sso2 (Fig. 4B), and pPpdc1-rho3 (Fig. 4C) plasmids in the secretory pathway were individually transformed into cbh1- and cel3c-integrated transformants. The snc1 gene encodes a v-SNARE protein and has been already demonstrated to be able to improve AnGOx secretion in T. reesei [20]. sso2 encode t-SNARE proteins involved in vesicle fusion to the plasma membrane and rho3 codes for a ras-type small GTPase involved in cell polarity and vesicle fusion with the plasma membrane [28]. In the cbh1-transformant, all three component genes were able to improve AnGOx expression significantly. On day 6 post induction, while the GOx activity was 137 U/mL in the QM9414 parent strain, the activity reached to 168, 185, and 171 U/mL for the representative snc1-, sso2-, and rho3- transformants (Fig. 4D). However, when these genes were overexpressed in the cel3c-integrated transformant, no improvement was observed for any of the three genes (Fig. 4D). An RT-qPCR analysis indicated that at 24 h and 48 h post cellulose induction, the transcripts of all three genes (snc1, sso2, and rho3) were significantly increased due to the overexpression except that of sso2 in the QM9414-cel3c strain at 48 h (Fig. 4E and F).

Fig. 4
figure 4

Effect of overexpressing three component genes in the secretion pathway on the secretory production of AnGOx in cbh1-integrated and cel3c-integrated strains. A-C: The plasmid maps for pPpdc1-snc1 (A), pPpdc1-sso2 (B) and pPpdc1-rho3 (C). D: The glucose oxidase activities in QM9414-cbh1, QM9414-cbh1-snc1, QM9414-cbh1-sso2, QM9414-cbh1-rho3, QM9414-cel3c, QM9414-cel3c-snc1, QM9414-cel3c-sso2, and QM9414-cel3c-rho3 on day 6 post induction. E and F: The relative transcript levels of snc1 in QM9414-cbh1-snc1 (QM9414-cbh1 overexpressing the secretory component gene snc1), sso2 in QM9414-cbh1-sso2, rho3 in QM9414-cbh1-rho3, snc1 in QM9414-cel3c-snc1 (QM9414-cel3c overexpressing the secretory component gene snc1), sso2 in QM9414-cel3c-sso2, and rho3 in QM9414-cel3c-rho3 at 24 h (E) and 48 h (F) post cellulose induction. The transcript level of the corresponding genes in QM9414-cbh1 or QM9414-cel3c was set as the reference with a value of 1.0. The relative transcript levels of the genes in the other strains were calculated through dividing by the corresponding genes in the QM9414-cbh1 or QM9414-cel3c strains. *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001

AnGOx integration in cel3c increased gene expression in the secretory pathway

The higher transcription level of AnGOx in the cel3c locus, plus the inability of improving AnGOx expression by overexpressing the key component genes in the secretory pathway in the cel3c transformant, collectively pointed out to the hypothesis that the secretory pathway was altered when the AnGOx gene was inserted into the cel3c locus. Therefore, an RT-qPCR analysis was further used to determine the transcription of the above three selected secretory pathway component genes. At 24 h post cellulose induction, in comparison with QM9414, the transcription of snc1 and sso2 in QM9414-cbh1 was significantly decreased, while that in QM9414-cel3c remained nearly unchanged. The transcription of rho3 was almost identical in both strains, 1.5-fold higher than that in QM9414 (Fig. 5A). However, at 48 h, while those of snc1, sso3, and rho3 in QM9414-cbh1 were still lower or comparable to that in QM9414, those of snc1 and rho3 in QM9414-cel3c were 1.9- and 2.6-fold, higher respectively (Fig. 5B).

Fig. 5
figure 5

RT-qPCR analysis of the three secretory pathway component genes in the cbh1-integrated and cel3c-integrated T. reesei strains. A: Analysis of the transcription for samples taken at 24 h post induction; B: Analysis of the transcription for samples taken at 48 h post induction. Expression of AnGOx was induced with cellulose in these T. reesei strains. At 24 h and 48 h post induction, mycelia were collected. The total RNA was extracted from the mycelia and then reverse-transcribed to cDNA. In RT-qPCR analysis, the sar1 gene was used as the internal reference gene. For both the 2 time points and all three genes, the transcript abundance of the analyzed gene in the QM9414 was set as 1.0. The relative transcript level of the gene in QM9414-cbh1 and QM9414-cel3c were calculated through dividing by that in the QM9414 strain. ns not significant; *, 0.01 < P < 0.05; ****, P < 0.0001

The results undoubtedly indicated that integration of a heterologous gene in different loci can lead to much different expression levels. It is also suggested that the integration can significantly alter cellular activities of the cell physiology. In the case of AnGOx, integration in the cel3c locus appeared to be both more favorable for transcription at the early induction stage and enhance the secretory pathway machinery, which together contribute to the higher expression of AnGOx in the cel3c transformant. The current finding sheds light on iterative engineering of T. reesei for efficient expression of heterologous genes, pinpointing to the complex effects of integration loci on heterologous gene expression and the need to deliberately select the candidate loci for maximal transcription and secretion. Although in this study we only used the model AnGOx gene, it was expected that, for other heterologous genes, a similar strategy can also be applied. It was suggested that more integration loci, more component genes in the secretory pathway, and maybe key genes in other regulatory stages can be tested towards high efficiency in stimulating expression of the gene of interest.


Two important factors, i.e. the integration locus and the secretory pathway, were chosen in this study for investigation of their effects on expression of a heterologous gene in the filamentous fungus workhorse T. reesei. Using AnGOx as a model heterologous gene, it was demonstrated that integration in the cel3c locus was more efficient in transcription of the heterologous gene at the early stage of induction, generating 309 U/mL of AnGOx in the culture supernatant. Integration in the cel3c locus appeared to also potentiate the secretion ability of T. reesei, as expression of the secretory component genes snc1 and rho3 was elevated. Further overexpressing these secretory component genes improved AnGOx expression in the cbh1 transformant but not in the cel3c strain.

Materials and methods

Strains and culture conditions

The Escherichia coli Trans-T1 strain was used for plasmid construction, propagation, and maintenance in this study. The A. niger ZJ5 strain bearing the glucose oxidase gene was isolated from a forest soil sample, which was collected in the Yunnan Province of China. The T. reesei strain QM9414 (ATCC 26,921) was used in this study to express AnGOx. The QM9414 and its transformants were maintained on potato dextrose agar (PDA) plates at 28 °C for sporulation. Harvested spores were inoculated in the liquid minimal medium (MM, containing (NH4)2SO4, 5.0 g/L; KH2PO4, 15 g/L; MgSO4, 0.6 g/L; CaCl2, 0.6 g/L; FeSO4·7H2O, 0.005 g/L; MnSO4·H2O, 0.0016 g/L; ZnSO4·7H2O, 0.0014 g/L; CoCl2, 0.002 g/L) supplemented with 2% glucose and 0.5% wheat bran for mycelial growth.

Plasmid construction

To construct the plasmid (pGOx_cbh1) for targeted integration of the AnGOx-expresing cassette in the cbh1 locus, The 1788-bp AnGOx gene fragment was amplified by polymerase chain reaction (PCR) from the genomic DNA of A. niger ZJ5 with the primer pair GOx-F/R, while a 600-bp cbh2 terminator fragment was amplified from T. reesei QM9414 using the primer pair Tcbh2-F/R. All primer sequences were listed in Additional file 1: Table S1. The two DNA fragments were in vitro fused together to obtain a 2388-bp fragment by overlap extension PCR with the primers GOD-F and Tcbh2-R. A 600-bp cbh1 fragment was amplified from the genomic DNA of QM9414 by using the primer pair cbh1R-F/R and a 2471-bp DNA fragment containing the expression cassette of neomycin resistance gene for conferring G418 resistance was amplified from pM13-G418 using the primers G418-F/R [29]. The two DNA fragments were fused into a 3071-bp fragment via overlap extension PCR with the primers G418-F/cbh1R-R. The primers Pcbh1-F and Pcbh1-R were used to amplify a 1551 bp cbh1 promoter (Pcbh1) fragment from QM9414. The 2898 bp M13 fragment was amplified from pBlueScript-SK cloning vector with the primers M13-F and M13-R. The four fragments were mixed, and the entire 9908 bp recombinant plasmid (pGOx_cbh1) was assembled by using the One Step Cloning Kit of Vazyme (Nanjing, China) utilizing a Gibson assembly method. The other two plasmids (pGOx_cel3c and pGOx_cel3c_hyg) for targeted integration of the AnGOx-expressing cassette in the cel3c locus were similarly constructed.

The CRISPR/Cas9-mediated genome editing was used for targeted integration of the AnGOx-expressing cassette into one of the two selected genomic loci. In this process, two DNA fragments were used, with one for expressing a functional Cas9 and one for expressing a sgRNA targeting one of the specific locus. For the first DNA fragment, the 5323-bp Cas9-expression cassette from Streptococcus pyogenes was amplified from the pLC2 plasmid with the primers Cas9-F/R [30] for transformation. To construct the DNA fragment that specifically for integration in the cbh1 locus. Firstly, the small guide RNA (sgRNA) of cbh1 locus was predicted by, with the sequence 5ʹ GTCGGCCTGCACTCTCCAAT 3ʹ. Next, the primers sgRNASPF/R were used to amplify a 420-bp PU6-sgRNA(cbh1) fragment from pLC2, and the primers sgRNAcbhISSF/R were used to amplify a 96-bp sgRNA(cbh1)-scaffold from pLC2. Then, the two DNA fragments were fused to a 496-bp DNA fragment by overlap extension PCR with the primers sgRNASPF and sgRNASSR. Finally, for construction of pBlunt-sgRNA(cbh1), the sgRNAcbh1 fragment and Blunt Simple Cloning Vector were combined by using pEASY-Blunt Simple Cloning Kit of TransGen Biotech (Beijing, China). After sequencing correctly, sgRNASPF and sgRNASSR primers were used to amplify sgRNA(cbh1) for transformation. The same method was applied for prediction sgRNA (5ʹ- GTCATCCAGTCCTTCCATCA-3ʹ) of cel3c locus and construction of the sgRNA(cel3c) for targeting the cel3c locus.

The plasmids pPpdc1-snc1, pPpdc1-sso2, and pPpdc1-rho3 were used for overexpression of the three genes (snc1, sso2, and rho3) involved in the secretory pathway. For construction of pPpdc1-snc1, the pdc1 promoter, snc1 gene, and the pdc1 terminator were amplified from the genomic DNA of QM9414 using the primer pairs (pdc1 promoter: Ppdc1-F/R; snc1: snc1-F/R; pdc1 terminator: Tpdc1-F/R). The hph gene conferring hygromycin resistance was amplified from the pLC2 plasmid with the primers hyg(s)-F/R. Then these four fragments were mixed together and assembled into the NotI and XhoI restriction sites of pBlueScript-SK using the Gibson assembly method to finally generate the plasmid pPdc1-snc1. The other two plasmids were similarly constructed.

Targeted integration of AnGOx into the two genomic loci in T. reesei

The expression cassette of AnGOx was introduced into T. reesei by protoplast transformation. Transformation of T. reesei was carried out following the method described by Penttilla et al. with some modifications [31]. Briefly, freshly harvested spores of T. reesei were grown on PDA plates at 28 °C for 14 h. Then the mycelia were collected, washed with sterilized H2O, and treated with 10 mg/mL of Lysing Enzymes (L1412, Sigma-Aldrich, St. Louis, MO) plus 1 mg/mL of cellulase (ONOZUKAR-10). The incubation was continued at 30 °C and terminated when large amounts of protoplasts were released. The AnGOx-G418-expressing cassette, sgRNA fragment, and Cas9-expressing cassette were amplified from the plasmids pGOx_cbh1, pBlunt-sgRNA(cbh1) and pLC2 using the primers Pcbh1-F/cbhR-R sgRNASPF/SSR, and Cas9-F/R, respectively, and 10 μg each of the DNA fragments were mixed and co-transformed into T. reesei protoplasts. The transformants were selected on PDA agar plates supplemented with 100 μg/mL G418 for 3 d. Colonies were picked out and inoculated on PDA plates containing the corresponding antibiotics for further selection. PCR was used to verify whether the target gene was integrated into the cbh1, and cel3c sites with the primer pairs cbh1-VF/R and cel3c-VF/R, respectively. The same method was used to integrate the AnGOx-hyg-expressing cassette into the cel3c locus of strain QM9414-cbh1.

Overexpression of component genes in the secretory pathways

The QM9414-cbh1 and QM9414-cel3c strains (bearing targeted integration of AnGOx in the cbh1 and cel3c, respectively) were used for protoplast preparation. The protoplasts were transformed with 10 g of the DNA fragments containing each of the expressing cassettes for snc1, sso2, and rho3 (obtained by PCR with the primers Ppdc1-F and hyg(s)-R) and the transformants were spread and selected on PDA plates supplemented with 50 μg/mL hygromycin. Integration of the genes encoding the secretory pathway component proteins in the fungal chromosome was verified by PCR using the paired primers VF(snc1)/VR(hyg), VF(sso2)/VR(hyg) and VF(rho3)/VR(hyg), respectively.

Induction of AnGOx expression

The T. reesei strains transformed with the AnGOx gene were cultured on PDA plates for sporulation. Then freshly harvested spores (1 × 106/mL) were inoculated into the MM medium supplemented with 2% glucose and 0.5% wheat bran for mycelial growth. Mycelia were washed with distilled water and then transferred to MM plus 2% Avicel and 1.4% gluconic acid (a compound that can increase release of glucose oxidase into the fermentation broth) for AnGOx induction [32]. All cultures were carried out at 28 °C.

Assay of GOx activity

The glucose oxidase activity was determined according to the method described by Gao et al. [33]. Briefly, the reaction mixture containing 341 μM o-dianisidine in 2.5 mL 100 mM NaH2PO4/Na2HPO4 buffer (pH 6.0), 300 μl 18% (w/v) D-glucose, and 100 μl horseradish peroxidase (90 U/mL) were pre-heated at 30 °C for 2 min. Then, 100 μl enzyme was added and the system was incubated at 30 °C for 3 min. The reaction was terminated by the addition of 2 mL of 2 M sulfuric acid and determination of absorbance value at 540 nm. One unit of glucose oxidase activity (U) was defined as the enzyme required to transform 1 mol of D-glucose into gluconic acid and H2O2 in 1 min at 30 °C and pH 6.0.

Reverse transcription quantitative PCR

The transcript levels of AnGOx and the secretory component genes were measured by reverse transcription quantitative PCR (RT-qPCR) in a QuantStudio 6 Flex System. At 24 h and 48 h post induction, mycelia were collected for total RNA extraction. The mycelia were pulverized using a Mini-Beadbeater (BioSpec, Bartlesville, OK) and the total RNA was extracted by using the TRIzol reagent (Thermo Fisher Scientific, Waltham, MA). The total RNA (1 μg) was treated with DNase I and then reverse-transcribed to cDNA using the First Strand cDNA Maxima Synthesis kit (TOYOBO, Shanghai, China). RT-qPCR was performed in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, San Diego, CA) using a TransScript Green One-Step qRT-PCR SuperMix (TransGen, Beijing, China). The sar1 gene [34] was used as a reference. The primers in RT-qPCR were listed in Additional file 1: Table S1. The following PCR procedure was used: initial denaturation at 95 ℃ for 10 min and then 40 cycles of 94 ℃ for 10 s, 60 ℃ for 20 s, and 72 ℃ for 30 s. The transcript level of each gene was estimated by using the 2ΔΔCt method [35]. Briefly, the ΔCt value of each gene was calculated by subtracting the Ct value of the sar1 gene from those of the tested genes (ΔCt = Cttested − Ctsar1). The ΔΔCt value of each gene was calculated by subtracting the ΔCt value of the parent stain from that in the transformant stain (ΔΔCt = ΔCt (of the transformant) − ΔCt (of the parent).

Statistical analysis

All of the assays were carried out in triplicate. Statistical significance of the transcript levels was determined by t test analysis using the Prism GraphPad software (Insightful Science, San Diego, CA). For other data, one-way analysis of variance (ANOVA) was carried out to determine the significance in difference. Asterisks were used to indicate significant differences: *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001; ****, P < 0.0001; ns, not significant.

Data availability

All of the data generated in this study are available and have been already included in the main text and supplemental material.


  1. Cherry JR, Fidantsef AL. Directed evolution of industrial enzymes: an update. Curr Opin Biotechnol. 2003;14:438–43.

    Article  CAS  PubMed  Google Scholar 

  2. Nevalainen H, Bergquist P, Te’o VSJ. Making a bacterial thermophilic enzyme in a fungal expression system. Curr Protoc Protein Sci. 2018;92: e52.

    Article  PubMed  Google Scholar 

  3. Sun X, Xue X, Li M, Gao F, Hao Z, Huang H, Luo H, Qin L, Yao B, X S. Efficient coproduction of mannanase and cellulase by the transformation of a codon-optimized endomannanase gene from Aspergillus niger into Trichoderma reesei. J Agric Food Chem. 2017;65:11046–53.

    Article  CAS  PubMed  Google Scholar 

  4. Landowski CP, Mustalahti E, Wahl R, Croute L, Sivasiddarthan D, Westerholm-Parvinen A, Sommer B, Ostermeier C, Helk B, Saarinen J, Saloheimo M. Enabling low cost biopharmaceuticals: high level interferon alpha-2b production in Trichoderma reesei. Microb Cell Fact. 2016;15:104.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Su X, Schmitz G, Zhang M, Mackie R. Heterologous gene expression in filamentous fungi. Adv Appl Microbiol. 2012.

    Article  PubMed  Google Scholar 

  6. Wang Y, Liu R, Liu H, Li X, Shen L, Zhang W, Song X, Liu W, Liu X, Zhong Y. Development of a powerful synthetic hybrid promoter to improve the cellulase system of Trichoderma reesei for efficient saccharification of corncob residues. Microb Cell Fact. 2022;21:5.

    Article  PubMed  PubMed Central  Google Scholar 

  7. Foreman PK, Brown D, Dankmeyer L, Dean R, Diener S, Dunn-Coleman NS, Goedegebuur F, Houfek TD, England GJ, Kelley AS, et al. Transcriptional regulation of biomass-degrading enzymes in the filamentous fungus Trichoderma reesei. J Biol Chem. 2003;278:31988–97.

    Article  PubMed  Google Scholar 

  8. Lubertozzi D, Keasling JD. Marker and promoter effects on heterologous expression in Aspergillus nidulans. Appl Microbiol Biotechnol. 2006;72:1014–23.

    Article  CAS  PubMed  Google Scholar 

  9. Sasaguri S, Maruyama J, Moriya S, Kudo T, Kitamoto K, Arioka M. Codon optimization prevents premature polyadenylation of heterologously-expressed cellulases from termite-gut symbionts in Aspergillus oryzae. J Gen Appl Microbiol. 2008;54:343–51.

    Article  CAS  PubMed  Google Scholar 

  10. Sun X, Liang Y, Wang Y, Zhang H, Zhao T, Yao B, Luo H, Huang H, Su X. Simultaneous manipulation of multiple genes within a same regulatory stage for iterative evolution of Trichoderma reesei. Biotechnol Biofuels. 2022;15:26.

    Article  CAS  Google Scholar 

  11. Shen L, Gao J, Wang Y, Li X, Liu H, Zhong Y. Engineering the endoplasmic reticulum secretory pathway in Trichoderma reesei for improved cellulase production. Enzyme Microb Technol. 2022;152: 109923.

    Article  CAS  Google Scholar 

  12. Qin L, Jiang X, Dong Z, Huang J, Chen X. Identification of two integration sites in favor of transgene expression in Trichoderma reesei. Biotechnol Biofuels. 2018;11:142.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Wohlschlager L, Csarman F, Chang HC, Fitz E, Seiboth B, Ludwig R. Heterologous expression of Phanerochaete chrysosporium cellobiose dehydrogenase in Trichoderma reesei. Microb Cell Fact. 2021.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Long L, Zhao H, Ding D, Xu M, Ding S. Heterologous expression of two Aspergillus niger feruloyl esterases in Trichoderma reesei for the production of ferulic acid from wheat bran. Bioproc Biosyst Eng. 2018;41:593–601.

    Article  CAS  Google Scholar 

  15. Chai S, Zhu Z, Tian E, Xiao M, Wang Y, Zou G, Zhou Z. Building a versatile protein production platform using engineered Trichoderma reesei. ACS Synth Biol. 2022;11:486–96.

    Article  CAS  PubMed  Google Scholar 

  16. Siamphan C, Arnthong J, Tharad S, Zhang F, Yang J, Laothanachareon T, Chuetor S, Champreda V, Zhao XQ, Suwannarangsee S. Production of D-galacturonic acid from pomelo peel using the crude enzyme from recombinant Trichoderma reesei expressing a heterologous exopolygalacturonase gene. J Clean Prod. 2022;331: 129958.

    Article  CAS  Google Scholar 

  17. Madden J, Barrett C, Laffir FR, Thompson M, Galvin P, Riordan AO’. On-chip glucose detection based on glucose oxidase immobilized on a platinum-modified, gold microband electrode. Biosensors. 2021;11:249.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Hou W, Bao J. Evaluation of cement retarding performance of cellulosic sugar acids. Constr Build Mater. 2019;202:522–7.

    Article  CAS  Google Scholar 

  19. Wu S, Li T, Niu H, Zhu Y, Liu Y, Duan Y, Sun Q, Yang X. Effects of glucose oxidase on growth performance, gut function, and cecal microbiota of broiler chickens. Poultry SCI. 2019;98:828–41.

    Article  CAS  Google Scholar 

  20. Wu Y, Sun X, Xue X, Luo H, Yao B, Xie X, Su X. Overexpressing key component genes of the secretion pathway for enhanced secretion of an Aspergillus niger glucose oxidase in Trichoderma reesei. Enzyme Microb Technol. 2017;106:83–7.

    Article  CAS  PubMed  Google Scholar 

  21. Mello-de-Sousa TM, Rassinger A, Pucher ME, Castro LD, Persinoti GF, Silva-Rocha R, Pocas-Fonseca MJ, Mach RL, Silva RN, Mach-Aigner AR. The impact of chromatin remodelling on cellulase expression in Trichoderma reesei. BMC Genomics. 2015;16:588.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Pang A, Wang H, Luo Y, Yang Z. Dissecting cellular function and distribution of β-glucosidases in Trichoderma reesei. mBio. 2021;12(3):1–20.

    Article  Google Scholar 

  23. Nehlsen K, Schucht R, da Gama-Norton L, Kromer W, Baer A, Cayli A, Hauser H, Wirth D. Recombinant protein expression by targeting pre-selected chromosomal loci. BMC Biotechnol. 2009;9:100.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Chen R, Gao J, Yu W, Chen X, Zhai X, Chen Y, Zhang L, Zhou Y. Engineering cofactor supply and recycling to drive phenolic acid biosynthesis in yeast. Nat Chem Biol. 2022;18:520–9.

    Article  CAS  PubMed  Google Scholar 

  25. Glick BR. Metabolic load and heterologous gene expression. Biotechnol Adv. 1995;13:247–61.

    Article  CAS  PubMed  Google Scholar 

  26. Heimel K. Unfolded protein response in filamentous fungi-implications in biotechnology. Appl Microbiol Biotechnol. 2015;99:121–32.

    Article  CAS  PubMed  Google Scholar 

  27. Payne T, Finnis C, Evans LR, Mead DJ, Avery SV, Archer DB, Sleep D. Modulation of chaperone gene expression in mutagenized Saccharomyces cerevisiae strains developed for recombinant human albumin production results in increased production of multiple heterologous proteins. Appl Environ Microbiol. 2008;74:7759–66.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Saloheimo M, Pakula TM. The cargo and the transport system: secreted proteins and protein secretion in Trichoderma reesei (Hypocrea jecorina). Microbiol-Sgm. 2012;158:46–57.

    Article  CAS  Google Scholar 

  29. Yang J, Xu X, Pan Y, Guo L, Che Y, Liu G. PtaE catalyzes the phenol oxidative reaction of pestheic acid biosynthesis in Pestalotiopsis fici. Mycosystema. 2016;35:848–56.

    CAS  Google Scholar 

  30. Chen C, Liu J, Duan C, Pan Y, Liu G. Improvement of the CRISPR-Cas9 mediated gene disruption and large DNA fragment deletion based on a chimeric promoter in Acremonium chrysogenum. Fungal Genet Biol. 2020;134: 103279.

    Article  CAS  PubMed  Google Scholar 

  31. Penttila M, Nevalainen H, Ratto M, Salminen E, Knowles J. A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene. 1987;61:155–64.

    Article  CAS  PubMed  Google Scholar 

  32. Wu L, An M, An Q, Feng B. A preparation technology of glucose oxidase. Patent. 2017.

    Article  Google Scholar 

  33. Gao Z, Li Z, Zhang Y, Huang H, Li M, Zhou L, Tang Y, Yao B, Zhang W. High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization. Biotechnol Lett. 2012;34:507–14.

    Article  CAS  PubMed  Google Scholar 

  34. Steiger MG, Mach RL, Mach-Aigner RA. An accurate normalization strategy for RT-qPCR in Hypocrea jecorina (Trichoderma reesei). J Biotechnol. 2010;145:30–7.

    Article  CAS  PubMed  Google Scholar 

  35. Livak KJ, TD S. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–8.

    Article  CAS  PubMed  Google Scholar 

Download references


The authors sincerely thank Prof. Gang Liu (Institute of Microbiology, Chinese Academy of Sciences) for providing the plasmid pLC2.


This research was supported by the National Key Research and Development Program of China (2021YFC2100204 and 2021YFC2102400), the National Natural Science Foundation of China (32072769), the Tianjin Synthetic Biotechnology Innovation Capacity Improvement Project (TSBICIP-CXRC-067), and the National Chicken Industry Technology System of China (CARS-41).

Author information

Authors and Affiliations



W.J. performed research, analyzed data, and wrote the paper XW, XL, YW analyzed the data. FL, BX, HL, TT, WZ, and provided technical assistance XX and XS conceived the idea and designed research, analyzed data, and wrote the paper. All authors read and approved final manuscript.

Corresponding authors

Correspondence to Xinxin Xu or Xiaoyun Su.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1

: Table S1. Primers used in this study.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ji, W., Wang, X., Liu, X. et al. Combining manipulation of integration loci and secretory pathway on expression of an Aspergillus niger glucose oxidase gene in Trichoderma reesei. Microb Cell Fact 22, 38 (2023).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:
