- RESEARCH
- Open access
- Published:
Heterologous expression and antitumor activity analysis of syringolin from Pseudomonas syringae pv. syringae B728a
Microbial Cell Factories volume 17, Article number: 31 (2018)
Abstract
Background
Syringolin, synthesized by a mixed non-ribosomal peptide synthetase/polyketide synthetase in Pseudomonas syringae pv. syringae (Pss) B728a, is a novel eukaryotic proteasome inhibitor. Meanwhile, directly modifying large fragments in the PKS/NRPS gene cluster through traditional DNA engineering techniques is very difficult. In this study, we directly cloned the syl gene cluster from Pss B301D-R via Red/ET recombineering to effectively express syringolin in heterologous hosts.
Results
A 22 kb genomic fragment containing the sylA–sylE gene cluster was cloned into the pASK vector, and the obtained recombinant plasmid was transferred into Streptomyces coelicolor and Streptomyces lividans for the heterologous expression of syringolin. Transcriptional levels of recombinant syl gene in S. coelicolor M145 and S. lividans TK24 were evaluated via RT-PCR and the production of syringolin compounds was detected via LC–MS analysis. The extracts of the engineered bacteria showed cytotoxic activity to B16, 4T1, Meth-A, and HeLa tumor cells. It is noteworthy that the syringolin displayed anticancer activity against C57BL/6 mice with B16 murine melanoma tumor cells. Together, our results herein demonstrate the potential of syrinolin as effective antitumor agent that can treat various cancers without apparent adverse effects.
Conclusions
This present study is the first to report the heterologous expression of the entire syl gene cluster in Streptomyces strains and the successful expression of syringolin in both S. coelicolor M145 and S. lividans TK24. Syringolin derivatives demonstrated high cytotoxicity in vitro and in vivo. Hence, this paper provided an important foundation for the discovery and production of new antitumor compounds.
Background
Pseudomonas syringae pv. syringae (Pss) is a foliar bacterial pathogen that causes brown spot disease in snap beans (Phaseolus vulgaris L.) [1, 2] and produces a novel polyketide complex, known as syringolin [3, 4]. Application of syringolin at micromolar concentrations onto rice plants can induce resistance against rice blast fungus. However, Pss mutants are incapable of syringolin biosynthesis and induce defense reactions and resistance, revealing its marginal therapeutic activity against systemic fungal infections [5, 6]. Recently, syringolin has shown potent in vivo antitumor activity against neuroblastoma, ovarian, and leukemic cancer cells [7]. Such specificity of syringolin inhibits all three catalytic activities of eukaryotic proteasomes [8, 9]. The proteasome acting during protein degradation has been known as a biological target for the clinic treatment lately [10, 11]. Syringolin was confirmed as the notable peptide moiety in a 12-membered macrolactam ring structure, which also has two double bonds with (E)-configuration and an unusual urea moiety [12] (Fig. 1). The special chain reversal by ureido linkage was also present in natural products, anabaenopeptins [13], brunsvicamides [14], pacidomycins [15], mureidomycins [16], and napsamycins [17]. Syringolin is a bioactive member of the syrbactins family, which also includes glidobactins and cepafungins. N-acylation dramatically influences the inhibitory activity of syringolin to proteasome [18]. As a promising anti-cancer agent, syringolin has great antitumor activity in inhibiting growth and inducing apoptosis of neuroblastoma, ovarian cancer cells, and other tumor cells [19, 20].
The structure of syringolin. The ring structure consists of two non-proteinogenic amino acids, namely, 3,4-dehydrolysine and 5-methyl-4-amino-2-hexenoic acid. The α-amino group of the latter attaches to valine through a peptide bond, which in turn, is linked to a second valine residue via an unusual ureido group
The syringolin biosynthetic gene cluster spanned 22 kb in length and included five open reading frames (sylA–sylE). The NRPS module sequence in the chromosome generally determines the amino acid sequence of the peptide product [21] (Fig. 2) where sylA is a putative transcription activator; sylB hypothetically encodes the lysine reductase; sylC encodes a module predicted for valine activation [22]; sylD codes two typical NRPS modules that activate lysine (or dehydrolysine) and 5-methyl-4-amino-2-hexenoic acid (or its precursor); and sylE possibly serves as an exporter [23].
Arrangement of syl gene cluster and biosynthesis modules. Colored boxes represent open reading frames (ORFs) of syl gene cluster (a). Boxes labeled as C, A, and PCP represent condensation, activation, and peptide carrier protein domains of synthetase modules encoded by sylC and sylD, respectively. Circles denote putative β-ketoacyl synthetase (KS), acyl transferase (AT), dehydratase (DH), β-ketoreductase (KR), acyl carrier protein (ACP), and thioesterase (TE) domains of the polyketide-like module, which is also encoded by sylD (b)
The genetic manipulation for PKS/NRPS gene cluster is difficult to perform using conventional DNA engineering methods because of their large sizes (spanning 10–100 kb). Red/ET recombineering [17, 18], which is independent of restriction site location and DNA fragment size, has extraordinarily advanced the field of genetic manipulation by omitting many steps in standard restriction/ligation. Direct cloning was recently established based on full-length Rac prophage protein, RecE, and its partner RecT-mediated linear plus linear homologous recombination (LLHR) [24]. This efficient cloning approach, when applied to direct cloning of large gene clusters from genomic DNA, might greatly promote the course of genome mining and combinatorial biosynthesis of PKS/NRPS compounds.
In this study, we report the direct cloning of an intact syl gene cluster from the genomic DNA of Pss B301D-R and replaced its native promoter with PsnpA, a strong native promoter in Streptomyces, to actively produce the syl gene in heterologous hosts. We analyze the bioactivity of the recombinant products by treatment of several cancer cell lines and tumor model in mice to provide a suitable protocol for syringolin production and clinical application in the future.
Methods
Bacterial strains and culturing conditions
Various E. coli strains were cultured at 37 °C in Luria–Bertani (LB) medium supplemented with antibiotics. Kanamycin (30 μg/mL; Sigma Chemical Co., St. Louis, Mo.), blasticidin S (50 μg/mL), tetracycline (5 μg/mL), and ampicillin (100 μg/mL) were added to the growth media as required. Heterologous hosts, S. lividans TK24 and S. coelicolor M145 strains, were grown at 30 °C on M2 (0.4% glucose, 1% malt extract, 0.4% yeast extract, and 0.1% CaCO3) or in TSB medium (tryptic soy broth (Oxoid), 30 g/L) for metabolite analyses as previously reported [25]. MS-agar medium [14] was used to transfer the cosmids from E. coli into Streptomyces in accordance with the standard protocol [26]. Apramycin (50 μg/mL) and nalidixic acid (25 μg/mL) were supplemented in the medium whenever necessary.
Recombineering
All engineering used Red/ET recombination techniques as described previously [27, 28]. Red/ET-competent E. coli cells (50 μL) were electroporated with 0.3 μg of a linear fragment (either PCR product or fragment obtained from restriction). PCRs were performed with Phusion polymerase (New England Biolabs, GmbH, Frankfurt am Main, Germany). After electroporation, the selection of recombinants was carried out depending on antibiotic-resistant gene and examined by restriction analysis.
Direct cloning of the syl gene cluster
For direct cloning, genomic DNA from Pss B301D-R (GenBank: AJ548826) was digested with restriction enzymes, Asc I and SnaB I, to release the syl gene cluster region. Nco I and BamH I digests of plasmid p15Adir [12], served as the PCR template. DNA Oligos used for generation of p15A-IR-Tpaes-BSD-oriT-IR backbone (Tpaes: MycoMar transposase gene; IR: inverted repeat; BSD: blasticidin S-resistant gene) were as follows: (sequence as homologous arm for recombineering is in lowercase)
- Syldir5::
-
5′-ttgcactctgttcgaactcccattccagcttttgtctgccggtgcttttttcatggccaaccgtatcaccgcgcaatgaaagtg
ccatcacATTTGATCCTCGTTATCTAG-3′;
- Syldir3::
-
5′-tgcggcgaagctttgcatgacccagtgcagtacgtccgggtccagcagatgccattcgcgacgcgccttgaccaccgtg
ccgacacgcggccAAGCTTGACCTGTGAAGTGAAAAATG-3′.
PCR product and linear genomic DNA were co-transformed into recombineering proficient competent GBdir cells to obtain p15A-syl-IR-Tpaes-BSD-oriT-IR. Sequencing the syl gene used primers sylseq-up (5′-ccggcctacacgcattc sylA end) and sylseq-down (5′-agcaacctggatgtacgg sylE end).
Engineering the syl gene cluster
To obtain highly heterologous expression in Streptomyces strain, a strong promoter PsnpA was inserted in front of the syl gene in p15A-syl-IR-Tpaes-BSD-oriT-IR to form the p15A-syl-IR-Tpaes-BSD-oriT-IR construct. The PsnpA-apra cassette (apra: apramycin-resistant gene) was prepared with Psnpsyl5 (5′-TTAATGATGTCTCGTTTAGATAAAAGTAAAGTGATTAACAGCGCATTAGCGCGCCTATCCTCCATGGTATAAATCG-3′) and Psnpsyl3 (5′-GGAATTAATCATCTGGCCATTCGATGGTGTCGGGTCATGTGAGCAAAAGGGAAGCCGCGGGAGTAATCCT-3′).
Conjugation into streptomyces
The engineered syl gene cluster was introduced into the chromosome of Streptomyces strains by triparental mating using E. coli helper strain HB101 (pRK2013). The mating mixture was plated on MS agar medium and incubated at 30 °C for 18 h. These plates were overlaid with 1 mL of water containing 500 μg of nalidixic acid and 1 mg of apramycin and incubated further for 5 days at 30 °C. After two cycles of single-colony purification on selective plates, the ex-conjugants were tested by colony PCR (Taq-polymerase, Invitrogen) with the following primers below:
- sylC-checkF::
-
5′-ATGAGCACGCACCAGCACGC-3′;
- sylC-checkR::
-
5′-CATTCACCAACTGCCCTATC-3′;
- sylD-checkF::
-
5′-GGAGCAGACTTACGGTCAGA-3′;
- sylD-checkR::
-
5′-TAGCCAGCATATTTTCCAGC-3′;
- sylE-checkF::
-
5′-TGGCGTTGACACTTTATTCA-3′;
- sylE-checkR::
-
5′-CAACGTTACCCGCAAATATC-3′.
RNA extraction and RT-PCR analysis
Total RNA was extracted by the TRIzol®(Invitrogen) method. The RNA quality was analyzed by absorbance measurement and formaldehyde-denatured agarose gel electrophoresis. RT-PCR of syl gene cluster was performed based on the previous protocol [29]. Control (RT-minus) reaction including all components for RT-PCR except the reverse transcriptase enzyme excluded the presence of genomic DNA. The expression of 16S rRNA gene from heterologous host served as a positive internal control. Reverse transcription reactions were conducted with the primers: sylB5 (5′-TGGCGCATGACCGATTGCGT-3′), sylB3 (5′-TCGGCATGCACGGGGACAAC-3′), sylC5 (5′-ACTGCCAATGGGAGCGCGAC-3′), sylC3 (5′-CAACTTACCCG GCAGCGGCA-3′), sylD5 (5′-ACTATCGCGCTCGTGTCCAA-3′), sylD3 (5′-CAGCCCGATACCGTCAGAAA-3′), sylE5 (5′-AAAGCCTTGCGGCCGAGCAT-3′), sylE3 (5′-AACCAGGAGCACGTCGCAGC-3′), 16SRNA-F (5′-CTACCTCAAGCAGATCGGCAAG-3′), and 16SRNA-R (5′-GATCAGGTC CAGGAACGCCATG-3′).
HPLC analysis and mass spectrometry of syringolin
Recombinant Streptomyces strains were grown on an M2 medium for 7 days at 30 °C. For the metabolite analyses, supernatant cultures were extracted with equal volumes of ethyl acetate after centrifugation and dried in a rotary evaporator. The extracts were then dissolved in methanol and filtered (0.22 μm pore size). LC–MS/MS experiments were performed on LTQ XL hybrid mass spectrometer (Thermo Fisher Scientific, USA) coupled to a Finnigan LC system (Thermo Fisher Scientific). The extracts were subjected and desalted online in a reverse-phase pre-column (C18 Pepmap column, LC Packings) and resolved on a nanoscale C18 Pepmap TM capillary column (LC Packings) at a flow rate of 0.4 mL/min (solvent A = 0.1% formic acid in H2O; solvent B = acetonitrile and 0.1% formic acid; 0–15 min 95% A and 5% B to 95% B [linear gradient], followed by 5 min 5% A and 95% B). Detection was carried out in positive ion model, auto MSn. Syringolins were identified by comparing the retention times and MS2 data identified from the original producer.
Bioactivity assays
Cell viability and death was determined by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay for adherent B16, HeLa, 4T1, and MethA cells in 96-well plates as described [12, 25]. Cells were incubated with 10 or 20 μL syringolin extracts from Streptomyces strains for 48–72 h, and the optical density (OD) of each well was determined in an ELISA reader at 560 nm.
In vivo therapeutic assessment was carried out using 4T1 breast tumor model and B16 melanoma tumor model as described previously [1]. SPF female BALB/c and C57BL/6 mice, aged 6–8 weeks old, were purchased from the SLRC Laboratory Animal Company in Hunan, China. Animals were bred and maintained in SPF conditions and were kept for at least 3 days before use. Tumors in the fourth mammary pads of female BALB/c mice were established with 1 × 105 4T1 mouse breast tumor cells, and C57BL/6 mice were implanted with SC tumors by injecting with 1 × 105 B16 cells on the mid-right side. After the tumor volume reached ~ 0.2 cm3, breast tumor model BALB/c mice were randomly assigned to seven groups, and C57BL/6 mice bearing B16 tumor were randomly assigned to four groups. Syringolin extracts were injected for every 2 days within a span of 10 days. Tumor weights were estimated using two-dimensional caliper measurements conducted thrice per week using the formula: tumor weight (mg) = (a × b2)/2, where a and b are the tumor length and width in mm, respectively. At a defined time, mice were sacrificed by cervical dislocation. However, moribund animals characterized by irregular respiration, tremors, absence of voluntary response to external stimuli, and coma were killed for humane reasons and considered as animals that died during survival experiments. All animal experiments were repeated thrice in this study. All animal experiments followed the National Institutes of Health Guide for the Care and Use of Laboratory Animals and obtained the approval from the Animal Ethics Committee of Hunan Normal University.
Histology
Primary tumors, liver, kidney, and spleen from tumor-bearing and control mice were harvested and fixed in 10% buffered formalin. Standard hematoxylin and eosin (HE) staining procedures were employed for morphological assessment [30]. The paraffin embedded samples were cut into 5 μm sections, and every twentieth section was stained and examined by microscopy.
Results and discussion
Direct cloning of intact sly gene cluster
The syl gene cluster from Pss B301D-R was isolated through Red/ET direct cloning. Plasmid pAsk-amp-syl (Fig. 3a) was constructed after PCR amplification of the minimal replicon with 90-nucleotide homology arms at the start and end of the syl gene. Digestion with PstI and DNA sequencing revealed the presence of an intact syl gene. For successful integration into the chromosome and heterologous expression in Streptomyces strains, the resulting plasmid, p15A-Tpase-syl (Fig. 3b) was generated through triple recombination [31]. One fragment contained the BamH I/Xba I restriction enzyme sites of p15Adir while the second one employed from PCR introduces a new promoter, PsnpA, a regulator snpR, and another IR sequence. BSD- and kanamycin-resistant colonies were cultured and verified by restriction analysis. This direct cloning method led to less mutations and much longer target DNA fragments than the approach achieved by PCR, because their cloning depends on the E. coli replication machinery and not on PCR, which is error-prone. Obviously, the technique is easier and faster than the standard method needed to establish and to screen the genomic DNA library.
The recombinant syl gene cluster was introduced and was integrated into Streptomyces strains and chromosome through a well-established E. coli: Streptomyces intergeneric conjugation protocol [32]. Syringolin compounds are synthesized by enzymatic actions of the sylB, sylC, and sylD gene products, and the generation and condensation of the ureido valine remained enigmatic. The modified PsnpA promoter with native transcription-active sylA gene proved the efficient expression of the syl gene cluster in Streptomyces heterologous hosts.
Identification gene transcriptional levels of syl gene cluster in heterologous expression hosts
Transcriptional levels of recombinant syl gene in S. coelicolor M145 and S. lividans TK24 were evaluated via RT-PCR. Total RNA was extracted after fermentation for 24, 32, 38, 46, and 52 h. The syl gene cluster is well-expressed in both Streptomyces hosts (Fig. 4). sylC and sylD gene, which manages the extension of the core ring backbone, started the transcription process at 24 h. sylB catalyzed the reduction of the intermediate product. During the late fermentation period, sylE encoded thioesterase to release the syringolin compounds.
Biosynthesis of syringolin in heterologous Streptomyces host
HPLC analysis showed the presence of three metabolite peaks in the culture broth of both S. coelicolor M145/PsnpA-syl and S. lividans TK24/PsnpA-syl mutants in comparison with the individual native strains of S. coelicolor M145 and S. lividans (Fig. 5a). In order to compare the yield of syringolin compounds in Streptomyces coelicolor M145 and Streptomyces lividans TK24, we measured and calculated the peak area of the major derivatives produced by the software Bruker Compass. The results showed that the production of syringolin derived compounds produced by heterologous host S. coelicolor M145 was about 1.3-fold that of S. lividans TK24. This 1.3-fold difference in the syringolin yield of S. lividans TK24/PsnpA-syl might have resulted from the diverse regulatory system in heterologous hosts. Overexpression of novG CstrR-like positive regulatory protein confers a higher PKS/NRPS synthesis activity to S. coelicolor M145 [33]. UV spectra, retention time (R t ), and MS/MS2 results in HPLC/MS comparisons revealed that all known syringolins A, B, C, D, E, and F (SylA–SylF) were detected in the extract of the two heterologous production hosts (Fig. 5b–d). The three peaks represented C24H39N5O6 (syringolin A/B, 1, R t = 2.1 min, m/z 494 [M + H]+), C26H43N5O6 (syringolin F, 2, R t = 4.03 min, m/z 522 [M + H]+), and C25H41N5O6 (syringolin C/D/E, 3, R t = 8.37 min, m/z 508 [M + H]+). Low-resolution ESI–MS analyses further showed that the mass of 1 is lower by 14 and 28 amu compared with that of 3 and 2, respectively. These results indicated that their real molecular weights of 1, 3, and 2 might be 493, 507, and 521 Da, respectively, suggesting the single methylene group (–CH2–) difference, preferably at the R1 or R2 group among the compounds. The molecular formula of the syringolin derivative obtained through high-resolution EI-MS matched the predicted structure.
In vitro antitumor activity of recombinant syringolin compounds
We investigated the antitumor activity of recombinant syringolin on different tumor cell lines, and the results suggested that the extracts of the recombinant Streptomyces strains induced varying levels of cytotoxicity. All samples obtained from ethanol extraction methods were dried and resuspended in PBS, and the differences between the control and treatment groups were significantly and statistically different (P < 0.05), thus, confirming our results. Incubation of 4T1, B16, HeLa, and MthA cancer cells with 15, 30, 45, and 60 μM syringolin extracts for 24 h significantly reduced cell viability, as demonstrated by the reduction of MTT. Recombinant extracts showed dose-dependent cytotoxicity on all compounds. The effect of the extracts on cancer cells was evaluated (Fig. 6). Syringolin has IC50 values of 22.5, 24.3, 26.4, and 35.2 μM towards 4T1, HeLa, B16, and MthA, respectively. MTT analysis showed that the syringolin compound has good cytotoxicity to the above four cell lines at low concentrations (Fig. 7).
In vivo antitumor activity of recombinant syringolin compounds
We constructed two tumor models to analyze the in vivo toxicity of syringolin compounds. All mice were given 30 or 60 μM dose of syringolin extract every 2 days for 10 days. BALB/c mice bearing 4T1 tumor were treated with syringolin compounds through gastric lavage (Fig. 8a), intratumoral injection (Fig. 8b), or intravenous injection (Fig. 8c), and syringolin compounds had significant effect on 4T1 from the latter two methods (P < 0.05), but had no in vivo activity from former treatment. Among the three methods, intravenous injection gave the greatest effect with 67% in vivo inhibition rate to the 4T1 tumor at 30 μM, and extended mice mortality, resulting in delayed growth and death. Syringolin compounds by intratumoral injection could inhibit 40% tumor growth at higher concentration, and the injected mice survived under good conditions. Tumor, liver, kidney, and spleen were harvested and subjected to HE staining. Syringolin did not only increase apoptosis of 4T1 cells but also protected the liver and kidney from injury (Fig. 9). Organs from control mouse models showed significant liver and kidney damage while cells from the drug-treated group were normal and did not change much. Syringolin treatment of C57BL/6 mice bearing B16 tumor by intratumoral injection also showed great in vivo antitumor activity in a dose-dependent manner at 30 μM concentration with about 75% inhibition rate to B16 (Fig. 8d). B16 tumor growth almost stopped after injection of syringolin compound. Together, our results herein demonstrate the potential of syrinolin as effective anitumor agent that can treat various cancers without apparent adverse effects.
Conclusions
This paper is first to express the whole syl gene cluster in heterologous Streptomyces strains. As sylA gene activates the expression of NRPS/PKS, acquisition of intact syl gene cluster uses the LLHR straightforward strategy mediated by Red/ET recombineering. The promoter underwent exchange after one round of LLHR. The results clearly indicate that the clusters of genes are capable of encoding proteins that synthesize syringolin. In comparison with the native promoter from Pseudomonas syringae pv. syringae, the general promoter, PsnpA, successfully transcribed the whole gene cluster in heterologous strains. Large natural product biosynthetic gene clusters traditionally require reconstruction from several cosmids, which is time-consuming given the required screening process from a genomic library and subsequent cloning steps. Our direct-cloning method furnishes a general tool of reconstituting large gene clusters. When coupled with suitable heterologous expression hosts, direct cloning is effective alternative in investigating or engineering known and unknown biosynthetic pathways, from slow-growing bacteria and poorly established genetic systems.
Subsequently, the expression of the clone in both M145 and TK24 produce six syringolin family members, which show diverse transcriptions of the syl gene regulated by synthetic promoters. Syringolin yield is about 1.5 mg/mL. Replacement of some strong promoters, like ermEp, fdmR1, or novG might regulate the gene transcription. Another possible measure in developing the production is to optimize the fermentation of heterologous stains.
Syringolin derivants demonstrated high cytotoxicity to B16, 4T1, Meth-A, and HeLa cells in vitro and to 4T1 model BALB/c mice and B16 melanotic C57BL/6 mice in vivo. SylA could preferentially target the β2 and β5 of the proteasome in vitro and in vivo. Structure–activity analysis revealed that the dipeptide tail of SylA contributed to β2 specificity and identified a nonreactive SylA derivative being essential for imaging experiments. The syringoline family members showed their activities of labeling nuclear and cytoplasmic proteasomes in our research.
This research provided new avenues and ideas for the discovery and production of new antitumor compounds. The antitumor effects of syringolin may be attributable to the inhibition of proteinase and cancer cell invasion, and its concrete mechanism of inducing apoptosis in cancer cells still needs further studies.
References
Lindemann J, Arny DC, Upper CD. Use of an apparent infection threshold population of Pseudomonas syringae to predict incidence and severity of brown spot of bean. Phytopathology. 1984;74(11):1334–9.
Vanneste JL. The scientific, economic, and social impacts of the New Zealand outbreak of bacterial canker of Kiwifruit (Pseudomonas syringae pv. actinidiae). Ann Rev Phytopathol. 2017;55:377–99.
Waspi U, Blanc D, Winkler T, Ruedi P, Dudler R. Syringolin, a novel peptide elicitor from Pseudomonas syringae pv. syringae that induces resistance to Pyricularia oryzae in rice. Mol Plant Microbe Interactions. 1998;11(8):727–33.
Hofstetter SS, Dudnik A, Widmer H, Dudler R. Arabidopsis YELLOW STRIPE-LIKE7 (YSL7) and YSL8 transporters mediate uptake of Pseudomonas virulence factor syringolin A into plant cells. Mol Plant Microbe Interactions. 2013;26(11):1302.
Wäspi U, Hassa P, Staempfli AA, Molleyres LP, Winkler T, Dudler R. Identification and structure of a family of syringolin variants: unusual cyclic peptides from Pseudomonas syringae pv. syringae that elicit defense responses in rice. Microbiol Res. 1999;154(1):89–93.
Reimmann C, Hofmann C, Mauch D, Dudler R. Characteriztaion of a rice gene induced by Pseudomonas syringae pv. syringae: requirement for the bacterial lemA gene function. Physiol Mol Plant Pathol. 1995;46(1):71–81.
Coleman CS, Rocetes JP, Park DJ, Wallick CJ, Warncramer BJ, Michel K, Dudler R, Bachmann AS. Syringolin A, a new plant elicitor from the phytopathogenic bacterium Pseudomonas syringae pv. syringae, inhibits the proliferation of neuroblastoma and ovarian cancer cells and induces apoptosis. Cell Prolif. 2006;39(6):599.
Ramel C, Baechler N, Hildbrand M, Meyer M, Schädeli D, Dudler R. Regulation of biosynthesis of syringolin A, a Pseudomonas syringae virulence factor targeting the host proteasome. Mol Plant Microbe Interactions. 2012;245(2):1198–208.
Groll M, Schellenberg B, Bachmann AS, Archer CR, Huber R, Powell TK, Lindow S, Kaiser M, Dudler R. A plant pathogen virulence factor inhibits the eukaryotic proteasome by a novel mechanism. Nature. 2008;452(7188):755.
Almond JB, Cohen GM. The proteasome: a novel target for cancer chemotherapy. Leukemia. 2002;16(4):433.
Jr PS, Shanker A. Development of proteasome inhibitors as therapeutic drugs. J Clin Cell Immunol. 2012;S5(S5):5.
Fu J, Bian X, Hu S, Wang H, Huang F, Seibert PM, Plaza A, Xia L, Müller R, Stewart AF. Full-length RecE enhances linear–linear homologous recombination and facilitates direct cloning for bioprospecting. Nat Biotechnol. 2012;30(5):440.
Harms H, Kurita KL, Pan L, Wahome PG, He H, Kinghorn AD, Carter GT, Linington RG. Discovery of anabaenopeptin 679 from freshwater algal bloom material: insights into the structure-activity relationship of anabaenopeptin protease inhibitors. Bioorg Med Chem Lett. 2016;26(20):4960.
Harada KI, Fujii K, Mayumi T, Hibino Y, Suzuki M, Ikai Y, Oka H. A method using L/CMS for determination of absolute configuration of constituent amino acids in peptide—advanced Marfey’s method. Tetrahedron Lett. 1995;36(9):1515–8.
Walther T, Renner S, Waldmann H, Arndt HD. Synthesis and structure–activity correlation of a brunsvicamide-inspired cyclopeptide collection. Chembiochem A Eur J Chem Biol. 2009;10(7):1153.
Grüschow S, Rackham EJ, Elkins B, Newill PL, Hill LM, Goss RJ. New pacidamycin antibiotics through precursor-directed biosynthesis. ChemBioChem. 2009;10(2):355–60.
Ye ZW, Camus S, Augustijns P, Annaert P. Napsamycins, new Pseudomonas active antibiotics of the mureidomycin family from Streptomyces sp. HIL Y-82,11372. J Antibiot. 1994;47(5):595–8.
Clerc J, Groll M, Illich DJ, Bachmann AS, Huber R, Schellenberg B, Dudler R, Kaiser M. Synthetic and structural studies on syringolin A and B reveal critical determinants of selectivity and potency of proteasome inhibition. Proc Natl Acad Sci USA. 2009;106(16):6507.
Kitahata S, Chiba T, Yoshida T, Ri M, Iida S, Matsuda A, Ichikawa S. Design, synthesis, and biological activity of isosyringolin A. Org Lett. 2016;18(9):2312.
Chiba T, Kitahata S, Matsuda A, Ichikawa S. Design, synthesis and biological evaluation of a structurally simplified syringolin A analogues. Chem Pharm Bull. 2016;64(7):811–6.
Amrein H, Makart S, Granado J, Shakya R, Schneider-Pokorny J, Dudler R. Functional analysis of genes involved in the synthesis of syringolin A by Pseudomonas syringae pv. syringae B301 D-R. Mol Plant Microbe Interactions. 2004;17(1):90.
Imker HJ, Walsh CT, Wuest WM. SylC catalyzes ureido-bond formation during biosynthesis of the proteasome inhibitor syringolin A. J Am Chem Soc. 2009;131(51):18263–5.
Wuest WM, Krahn D, Kaiser M, Walsh CT. Enzymatic timing and tailoring of macrolactamization in syringolin biosynthesis. Org Lett. 2011;13(17):4518–21.
Yuan LZ, Rouvière PE, Larossa RA, Suh W. Chromosomal promoter replacement of the isoprenoid pathway for enhancing carotenoid production in E. coli. Metab Eng. 2006;8(1):79–90.
Chen TC, Wang W, Golden EB, Thomas S, Sivakumar W, Hofman FM, Louie SG, Schönthal AH. Green tea epigallocatechin gallate enhances therapeutic efficacy of temozolomide in orthotopic mouse glioblastoma models. Cancer Lett. 2011;302(2):100–8.
Kieser T. Practical streptomyces genetics. Norwich: John Innes Foundation; 2000. p. 30.
Muyrers JP, Zhang Y, Stewart AF. Techniques: recombinogenic engineering—new options for cloning and manipulating DNA. Trends Biochem Sci. 2001;26(5):325.
Muyrers JP, Zhang Y, Testa G, Stewart AF. Rapid modification of bacterial artificial chromosomes by ET-recombination. Nucleic Acids Res. 1999;27(6):1555.
Luo Y, Ding X, Xia L, Fan H, Li W, Huang S, Ying T, Sun Y. Comparative proteomic analysis of saccharopolyspora spinosa SP06081 and PR2 strains reveals the differentially expressed proteins correlated with the increase of spinosad yield. Proteome Sci. 2011;9(1):40.
Zhang Y, Zhang Y, Xia L, Zhang X, Ding X, Yan F, Wu F. Escherichia coli Nissle 1917 targets and restrains mouse B16 melanoma and 4T1 breast tumors through expression of azurin protein. Appl Environ Microbiol. 2012;78(21):7603.
Zhang Y, Muyrers JP, Testa G, Stewart AF. DNA cloning by homologous recombination in Escherichia coli. Nat Biotechnol. 2000;18(12):1314.
Fu J, Wenzel SC, Perlova O, Wang J, Gross F, Tang Z, Yin Y, Stewart AF, Müller R, Zhang Y. Efficient transfer of two large secondary metabolite pathway gene clusters into heterologous hosts by transposition. Nucleic Acids Res. 2008;36(17):e113.
Borissenko L, Groll M. 20S proteasome and its inhibitors: crystallographic knowledge for drug development. Chem Rev. 2007;38(22):687–717.
Authors’ contributions
FH and LH designed and carried out the experiments, JLT analysed the data and prepared the manuscript. XZD and SYH carried out the HPLC analysis and LC/MS analysis of the syringolin. YMZ and YJS gave valuable suggestions in the experiments and manuscript editing. LQX supervised the research. All authors read and approved the final manuscript.
Acknowledgements
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Availability of data and materials
The datasets supporting the conclusions of this article are included within the article.
Consent for publication
The authors are consent for publication.
Ethics approval and consent to participate
All animal experiments followed the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Animal Ethics Committee of Hunan Normal University.
Funding
This work was supported by the National Basic Research Program (973) of China (2012CB722301), the National High Technology Research and Development Program (863) of China (2011AA10A203), the International Cooperation Project (0102011DFA32610), and the Cooperative Innovation Center of Engineering and New Products for Developmental Biology of Hunan Province (20134486).
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
About this article
Cite this article
Huang, F., Tang, J., He, L. et al. Heterologous expression and antitumor activity analysis of syringolin from Pseudomonas syringae pv. syringae B728a. Microb Cell Fact 17, 31 (2018). https://doi.org/10.1186/s12934-018-0859-1
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12934-018-0859-1