- Research
- Open Access
Bacillus thuringiensis subsp. kurstaki HD1 as a factory to synthesize alkali-labile ChiA74∆sp chitinase inclusions, Cry crystals and spores for applied use
https://doi.org/10.1186/1475-2859-13-15
© Barboza-Corona et al.; licensee BioMed Central Ltd. 2014
- Received: 20 November 2013
- Accepted: 20 January 2014
- Published: 24 January 2014
Abstract
Background
The endochitinase ChiA74 is a soluble secreted enzyme produced by Bacillus thuringiensis that synergizes the entomotoxigenecity of Cry proteins that accumulate as intracellular crystalline inclusion during sporulation. The purpose of this study was to produce alkaline-soluble ChiA74∆sp inclusions in B. thuringiensis, and to determine its effect on Cry crystal production, sporulation and toxicity to an important agronomical insect, Manduca sexta. To this end we deleted the secretion signal peptide-coding sequence of chiA74 (i.e. chiA74∆sp) and expressed it under its native promoter (pEHchiA74∆sp) or strong chimeric sporulation-dependent cytA-p/STAB-SD promoter (pEBchiA74∆sp) in Escherichia coli, acrystalliferous B. thuringiensis (4Q7) and B. thuringiensis HD1.
Results
Based on mRNA analyses, up to ~9-fold increase in expression of chiA74∆sp was observed using the cytA-p/STAB-SD promoter. ChiA74∆sp (~70 kDa) formed intracellular inclusions that frequently accumulated at the poles of cells. ChiA74∆sp inclusions were dissolved in alkali and reducing conditions, similar to Cry crystals, and retained its activity in a wide range of pH (5 to 9), but showed a drastic reduction (~70%) at pH 10. Chitinase activity of E. coli- pEHchiA74∆sp was ~ 150 mU/mL, and in E. coli- pEBchiA74∆sp, 250 mU/mL. 4Q7-pEBchiA74∆sp and 4Q7-pEHchiA74∆sp had activities of ~127 mU/mL and ~41 mU/mL, respectively. The endochitinase activity in HD1-pEBchiA74∆sp increased 42x when compared to parental HD1 strain. HD1-pEBchiA74∆sp and HD1 harbored typical bipyramidal Cry inclusions, but crystals in the recombinant were ~30% smaller. Additionally, a 3x increase in the number of viable spores was observed in cultures of the recombinant strain when compared to HD1. Bioassays against first instar larvae of M. sexta with spore-crystals of HD1 or spore-crystal-ChiA74∆sp inclusions of HD1- pEBchiA74∆sp showed LC50s of 67.30 ng/cm2 and 41.45 ng/cm2, respectively.
Conclusions
Alkali-labile ChiA74∆sp inclusion bodies can be synthesized in E. coli and B. thuringiensis strains. We demonstrated for the first time the applied utility of synthesis of ChiA74∆sp inclusions, Cry crystals and spores in the same sporangium of HD1, a strain used successfully worldwide to control economically significant lepidopteran pests of agriculture. Our findings will allow to us develop strategies to modify expression of ChiA74∆sp while maximizing Cry crystal synthesis in commercial strains of B. thuringiensis.
Keywords
- Bacillus thuringiensis
- Endochitinase ChiA74
- Cry proteins
- Inclusion bodies
Background
Bacillus thuringiensis, B. sphaericus, Paenibacillus popilliae, Clostridium bifermentans and Brevibacillus laterosporus are spore-forming bacteria that produce intracellular crystalline or non-crystalline inclusions, many of which are toxic to insect pests of agriculture and medically significant vectors of disease [1, 2]. In particular, parasporal bodies of B. thuringiensis subsp. kurstaki (HD1) and B. thuringiensis subsp. israelensis, toxic to lepidopteran and dipteran larvae, respectively, are among the most successful bioinsecticides used worldwide [3, 4], and are composed of a plethora of Cry (crystal) or Cyt (cytolytic) proteins that are synthesized and occluded during sporulation [5–8]. In addition to Cry and Cyt protoxins, B. thuringiesis also synthesizes a battery of soluble chitinolytic enzymes secreted during vegetative growth that hydrolyze environmental chitin substrates for use as carbon and nitrogen sources. Chitinases are generally produced at a markedly lower level than Cry and Cyt. As such, unlike Cry and Cyt, and perhaps disadvantageous to efficient commercial formulations, chitinases do not naturally accumulate as intracellular inclusions in bacterial cells [9–14].
From an applied perspective, chitinases could be a useful component of B. thuringiensis-based biopesticides as they could function to degrade chitin polymers present in the protective midgut peritrophic membrane of insect larvae. In fact, previous studies have demonstrated that the hydrolytic activity of chitinase synergizes the toxicological effects of Cry, presumably by enhancing binding of active toxin ligand to microvillar membrane receptors [11, 13–15]. Interestingly, it has been shown that when the chitinase gene of B. thuringiensis strain 4.0718 lacking its secretion signal peptide coding sequence was expressed under sporulation-dependent promoters, spherical intracellular inclusion accrued, and when these purified inclusions were mixed with Cry1Ac, an ~1.5x increase in toxicity against Spodoptera exigua and Helicoverpa armigera was observed [11]. Similar studies using secreted soluble chitinases have also demonstrated that these enzymes enhance the toxicity of Cry1Ac. For example, the chitinase gene of Nicotiana tabacum expressed simultaneously with cry1Ac in an acrystalliferous strain of B. thuringiensis using the BtI-BtII promoters showed increases in chitinolytic activity (6x) and toxicity (18×) of the recombinant bacterium against Helicoverpa armigera Hubner [14]. These methods of expression of chitinase genes under sporulation-dependent promoters appear to be more robust compared to the synthesis of unstable chimeric protein composed of Chi255 and the C-terminal half (crystallization domain) of Cry1Ac [15].
Recently, we have reported an unprecedented ~300-fold increase in synthesis of ChiA74, an endochitinase native to B. thuringiensis, in a recombinant strain of B. thuringiensis HD73 [16] when chiA74 was expressed under control of the strong chimeric promoters, cytA-p/ STAB-SD, developed by Park et al. (1998) [17]. In this study, we used the wildtype promoter of chiA74 or cytA-p/ STAB-SD to express chiA74 lacking the sequence coding for the secretion signal peptide (chiA74∆sp) in Escherichia coli, acrystalliferous B. thuringiensis subsp. israelensis strain 4Q7, and B. thuringiensis subsp. kurstaki HD1, a strain used successfully worldwide in agriculture as a biodegradable lepidopteran larvicide. Using this strategy, we were able to produce stable ChiA74∆sp inclusions in E. coli, and also, for the first time, intracellular ChiA74∆sp inclusion together with Cry crystals and spores in B. thuringiensis subsp. kurstaki HD1. We demonstrate the utility of the recombinant HD1 strain against larvae Manduca sexta. Our results lay a foundation for similar engineering of other commercial strains of B. thuringiensis.
Results
ChiA74Δsp accumulates as inclusion bodies in Escherichia coli
Expression of ChiA74Δsp in Escherichia coli DH5α and Bacillus thuringiensis 4Q7. (A) Schematic illustration of the strategy used to delete the secretion signal peptide-encoding sequence (shown as a rectangle inside the open reading frame) of chiA74 to generate chiA74∆ sp. Two constructs were developed, the first under regulation of wildtype promoter (wp) and the second under control of the strong cytA-p/STAB-SD promoter system. Lollipop indicates the putative transcriptional terminator site. Oligonucleotide sequences used to delete the signal peptide-coding sequence are shown in Table 1. (B) Evaluation of endochitinase activity using solubilized intracellular proteins produced in E. coli. Panel 1: Zymogram using 4-MU-(GlcNAc)3 for detection. Lane 1, E. coli- pEHchiA74∆sp; lane 2, without sample; lane 3, E. coli- pEBchiA74∆sp; lane 4, E. coli DH5α. Black arrow indicates the position of ChiA74∆sp in recombinant E. coli strains. Panel 2: (a) E. coli- pEHchiA74∆sp, (b) E. coli- pEBchiA74∆sp. No endochitinase activity was observed with E. coli DH5α. (C) Phase contrast microscopy of recombinant strains of B. thuringiensis. Panel 1, 4Q7; panel 2, 4Q7- pEHchiA74∆sp; panel 3, 4Q7- pEBchiA74∆sp. Black arrows indicate the positions of ChiA74∆sp inclusions. (D) Endochitinase activity determined using solubilized intracellular proteins of recombinant strains of B. thuringiensis. Panel 1: lane 1, 4Q7; lane 2, 4Q7- pEHchiA74∆sp; lane 3, 4Q7- pEBchiA74∆sp. Black arrow indicates the position of ChiA74∆sp in recombinant 4Q7 strains. Panel 2: (a) 4Q7- pEHchiA74∆sp, (b) 4Q7- pEBchiA74∆sp. Activity of recombinant bacteria was normalized with the residual intracellular endochitinase activity of 4Q7.
Confirmation of the intracellular location of ChiA74∆s p in Escherichia coli and Bacillus thuringiensis 4Q7 using a chimeric construct with the green fluorescent protein (GFP) gene. (A) Schematic illustration that shows the fusion of chiA74∆sp with gfp. Panel 1, two constructs were developed, under regulation of the chiA74 wildtype promoter (wp) or under control of the cytA-p/ STAB-SD system. Lollipop indicates transcriptional terminator. Oligonucleotides used to make chimeric construct with gfp are shown in Table 1. Panel 2, confirmation of chimeric constructs by PCR, primers used for amplification are showed in parenthesis and in Table 1. L, 1 kb (kilobase) DNA Ladder (New England Biolabs); Lane 1, pEHchiA74∆sp-gfp (primers: chiA74-1, chiA74-3); lane 2, pEHchiA74∆sp-gfp (primers: chiA74-1, gfp-3); lane 3, pEHchiA74∆sp-gfp (primers: gfp-1, chiA74-4); lane 4, pEBchi A74∆sp-gfp (primers: cytSTAB-1, chiA74-4); Lane 5, pEBchi A74∆sp-gfp (primers: cytSTAB-1, gfp-3); lane 6, pEBchi A74∆sp-gfp (primers: gfp-1, chiA74-4). (B) Phase contrast (left) and fluorescence micrographs (right) of recombinant strains of E. coli and B. thuringiensis strain 4Q7 expressing the chimeric protein ChiA74∆sp-GFP. Panel 1, E. coli- pEHchiA74∆sp-gfp; panel 2, 4Q7- pEHchiA74∆sp-gfp; panel 3, E. coli- pEBchiA74∆sp-gfp; panel 4, 4Q7- pEBchiA74∆sp-gfp; panel 5, E. coli DH5α; panel 6, 4Q7. Samples of recombinant strains of B. thuringiensis were collected at ~ 72 h.
ChiA74Δsp accumulates as intracellular inclusions in acrystalliferous Bacillus thuringiensis 4Q7
Relative expression level of chiA74 Δ sp transcripts in 4Q7 at different times. Expression of the endochitinase gene was regulated by its native promoter (white rectangles) or the strong chimeric sporulation-dependent cytA-p/STAB-SD promoters (gray rectangles).
ChiA74Δsp forms stable inclusions in HD1
Primers used for PCR construction and amplification of chiA74 ∆s p and chiA74 ∆s p-gfp
Primer | Sequencea |
---|---|
chiA74-13 | F: 5′-TCCCCGCGG ATG TCACCAAAGCAAAGTCAAAAAATTGTTGGGTAC-3′ |
chiA74-12 | R: 5′-TCCCCGCGG TTCTCCTTTCAAAATAAAAGATATATTTAAAGGC-3′ |
gfp-1 | F: 5′- ATGGCTAGCAAAGGAGAAGAACTTT-3′ |
gfp-3 | R: 5′- GGTCAGATCT TTATTTGTAGAGCTCATCCAT -3′ |
chiA74-C | F: 5′- GGTCAGATCT ACGTAATATCCATTAATTACTTCACTA -3′ |
chiA74-B | R: 5′- GTTTTCGCTAATGACGGCATTTAAAAG -3′ |
cyt-STAB-1 | F: 5′-CGGAATTCTATTTTCGATTTC-3′ |
chiA74-3 | R: 5-AACTGCAG CGAAAGCCTTTCCCTAACAGGTGACTATC-3′ |
ery-1 | F: 5-AAAACTGCAG CTTAAGAGTGTGTTGATAGTGC-3′ |
ery-2 | R: 5-ATAAGAATGCGGCCGC CCCCGTAGGCGCTAGGGACC-3 |
Expression of ChiA74Δsp in B. thuringiensis HD1. (A) Phase contrast micrograph of HD1 sporangia, (B) HD1-pEBchiA74∆sp sporangia, (C) HD1-pEBchiA74∆sp lysed culture. Triangle and triangle-wide wavy arrows indicate the presence of Cry crystals and ChiA74∆sp inclusion bodies, respectively. In (A) arrow shows a bipyramidal crystal (Cry1) associated with a cuboidal crystal (Cry2). ChiA74∆sp was fused to the GFP and expressed in HD1 to obtain HD1-pEBchiA74∆sp-gfp; (D) Phase contrast, and (E) fluorescence microscopy, black and white arrows indicate the crystal position. Fluorescence along the sporangium indicates that ChiA74∆sp was expressed and accumulated within the cell. (F) Confirmation of the transformation of HD1 by PCR. Lanes 1 and 5, HD1; Lanes 2 and 6, HD1-pEBchiA74∆sp; Lanes 3 and 7, E. coli-pEBchiA74Δsp; lanes 4 and 8, pBluescript KS (+) (Stratagene); L, 1 kb DNA Ladder (10, 8, 6, 5, 4, 3, 2, 1.5, 1 kb; New England Biolabs). Amplicons of lanes 1 to 4 and 5 to 8 were obtained using the primers ery1, ery2, and cytSTAB-1, chiA74-4, respectively. (G) SDS-PAGE and (H) zymogram of solubilized proteins obtained from sporulated and lysed HD1 (lane 1) and HD1-pEBchiA74∆sp (lane 2). Location of Cry1A, Cry2A proteins and endochitinase (ChiA74∆sp) are showed with black arrows. A reduction in the relative amount of Cry1 (~133 kDa) and Cry2A (~65 kDa) proteins was observed in the recombinant strain (lane 2) compared with wildtype HD1 (lane1). Zymogram detection was performed using the 4-MU-(GlcNAc)3 substrate. Asterisks indicate probable ChiA74∆sp degradation products. Protein molecular masses were deduced using the reference BenchMark protein ladder standard (Invitrogen, Carlsbad CA, USA).
Endochitinase activity (U)*, crystal area and viable spores of wildtype and recombinant strains of Bacillus thuringiensis
HD1 - pEBchiA74∆sp | HD1 | |
---|---|---|
mU/mL (±SD) | 127 (± 2.0)a** | 3.0 (± 0.2)b |
Ratio | 42.0 | 1.0 |
Crystal area (mμ2) (±SD) | 0.86 (± 0.16)a | 1.28 (± 0.19)b |
Ratio | 1.0 | 1.5 |
Spores/mL x 107 (±SD) | 8.35 (± 0.57)a | 2.95 (± 0.21)b |
Ratio | 2.83 | 1.0 |
Effect of pH on endochitinase activity of alkaline-solubilized ChiA74Δsp inclusion bodies produced in recombinant B . thuringiensis HD1. Lysed culture (~74 mL) of recombinant bacteria were solubilized in an alkaline and reducing solution and then evaluated against 4-MU-(GlcNAc)3 at a pH range of 4–10.
Bioassays
Statistical parameters for estimating the LC 50 of strains of B. thuringiensis against tobacco hornworm Manduca sexta
Strain | LC50 a | Slope | X2 | Mortality |
---|---|---|---|---|
HD1 | 67.29 (47.18-95.98) | 1.70 | 0.90 | 0 |
HD1-pEBchiA74∆sp | 41.45 (28.33-60.64) | 1.50 | 0.17 | 0 |
Discussion
The use of bacterial chitinases could be of significance in Bacillus thuringiensis-based biocontrol efforts because they synergize insecticidal Cry proteins produced by strains of this species [19–23]. Although increases in synthesis of extracellular chitinases in B. thuringiensis has been accomplished using various expression systems, the practical problem regarding the likely instability of potential mixtures of spore-crystal-soluble chitinase formulations remains to be resolved [9, 16]. Ideally, the production of physically stable, but biochemically (alkaline) labile, inclusions of chitinase and Cry crystals in the same cell could alleviate this concern. Hu et al. [11] successfully produced chitinase lacking its secretion signal peptide sequence as inclusions in an acrystalliferous B. thuringiensis strain. However, the concern was not resolved as chitinase inclusions and Cry crystals were synthesized in different bacterial strains of which preparations must be mixed for bioassays, or for prospective commercial formulations. In addition, their work as designed could not address the effect of chitinase synthesis on Cry crystal production and viable spore count of recombinant B. thuringiensis, two factors that must be optimized for potential applied and commercial consideration.
In the present study, we demonstrated that by deleting the secretion signal peptide sequence of ChiA74 (ChiA74∆sp), stable occluded ChiA74∆sp could be produced in different bacteria. First, we transformed E. coli with the constructs to produce sufficient recombinant plasmid DNA to transform B. thuringiensis. To our surprise we observed the formation of small inclusion bodies at the poles of E. coli and demonstrated they were composed of ChiA74∆sp. To our knowledge it is the first report that chitinase inclusion bodies can be produced in E. coli. We note that the synthesis of ChiA74∆sp as stable inclusions in E. coli could have biotechnological value, as it could be mass-produced and easily purified using an organism “generally recognized as safe” (e.g. E. coli K12) for applied used, such as for generating chitin-derived oligosaccharides with pharmaceutical and/or food preservation properties [10].
Our major objective in this work was to produce, for first time, ChiA74∆sp inclusions together with insecticidal crystals and spores in the same cell, study its cellular effect and determine the recombinant’s toxicity to an important agronomical insect such as M. sexta larvae. We observed the formation of ChiA74∆sp inclusions in the acrystalliferous B. thuringiensis 4Q7, and like in E. coli, they accumulated at the poles. Increased chitinase synthesis was observed when the endochitinase gene was expressed using the strong cytA-p/STAB promoter system developed by Park et al. (1998) (17), compared to regulation by its native promoter, and most likely was a result of increased chiA74∆sp mRNAs, as demonstrated by qPCR. Interestingly, when we transformed the crystalliferous strain B. thuringiensis HD1 with the endochitinase gene chiA74∆sp regulated by cytA-p/STAB, we observed two important changes in the recombinant strain: (i) a reduction in the crystal size (i.e. less Cry production) and (ii) a 3-fold increase in the number of viable spores. With regards to crystals, we observed an ~33% decrease in the Cry crystals area (Figure 4A,B,C; Table 2) similar to previous reports [9, 16], which correlated well with a decrease in Cry protein synthesis as detected by SDS-PAGE (Figure 4G). The increase in spore count was not expected based on results of a previous study where the opposite occurred following expression of heterologous chitinase (secreted) in B. thuringiensis[16]. Although we do not have supporting experimental evidence, it is possible that the synthesis of two kind of proteins, Cry and ChiA74, whose gene expression is controlled by two strong sporulation-dependent promoters (BtI-BtII, cyt-p/STAB) incur a more rapid depletion of nutrients thereby inducing sporulation. For example, it is known that the activation of Spo0A, a master regulator for entry into sporulation in B. subtilis, is induced in response to nutrient limitation [24, 25].
As suggested previously, the advantage of producing ChiA74∆sp inclusions in HD1 allow the direct use of spore-Cry crystals-ChiA74∆sp mixtures from a single source in bioassays, rather than mixing preparations from different strains as reported previously [11]. We were successful in engineering a recombinant HD1 strain producing ChiA74∆sp inclusions during sporulation that had a 42-fold increase in chitinase activity. Despite the marked increase in chitinase activity, only an apparent 1.6-fold increase in toxicity was observed against M. sexta first instar larvae. Similar results (1.5-fold increase) have been observed with mixtures of different recombinant strains producing chitinase inclusions and Cry1Ac against S. exigua and H. armigera[11]. It is likely that the decrease in Cry crystal synthesis in the recombinant strain lowered the expectations of several-fold increases in insecticidal activity of the recombinant. In addition, and probably of more significance, is the marked decrease (~70%) in enzymatic activity of preparations of ChiA74Δsp inclusions solubilized at pH 10 (Figure 5). It is worth noting that lepidopteran midguts normally show pH gradients from anterior to posterior, and from the lumen to epithelial microvilli. The midgut of M. sexta larva ranges in pH from ~10-11 [26]. Although it is evident that the lower LC50 of the recombinant strain is a consequence of an increase chitinase production with the compensating decrease in Cry crystal proteins, our results suggest that more “balanced” expression of both cry and chiA74Δsp could result in optimal production of these proteins conducive to an efficacious biopesticide.
In summary, we have produced ChiA74∆sp inclusion in HD1 and the recombinant showed an apparent increased activity against first instar M. sexta larvae. Our future studies include producing ChiA74∆sp inclusions in other lepidopteran-, coleopteran- and dipteran-specific strains of B. thuringiensis for bioassays against a wide variety of insect larvae. Finally, we are also in the process of using molecular strategies to modify expression of ChiA74∆sp, while at the same time maximizing the production of endogenous Cry proteins to develop highly efficacious strains of B. thuringiensis for applied use.
Conclusions
Inclusions of ChiA74Δsp can be produced in E. coli and B. thuringiensis strains. We show for the first time, the ability to synthesize ChiA74∆sp inclusions, insecticidal Cry crystals and spores in the same sporangium. We observed that the production of ChiA74∆sp inclusions affect the crystal size and sporulation in B. thuringiensis subsp. kurstaki HD1. The data reported in this study lay a foundation for developing strategies to modify expression of chiA74∆sp while maximizing the production of Cry proteins.
Material and methods
Bacterial strains and plasmids
Plasmids pEHchiA74 and pEBchiA74 harbor the chiA74 under the control of, respectively, the wild promoter (wp) and the 660-bp strong chimeric sporulation-dependent pcytA-p/STAB-SD promoter developed by Park et al. (1998) [17]. The wildtype Shine-Dalgarno (wSD) and transcription terminator (chiA74tt) sequences were retained in all constructs [9, 16]. These plasmids (pEHchiA74 and pEBchiA74) were used for deleting the signal peptide-encoding sequence of ChiA74 to obtain ChiA74Δsp (see below). All constructs (Figure 1A) were propagated in E. coli DH5α [supE44, DlacU169 (F80lacZDM15) hsdR17 recA1 end A1 gyrA96 thi-1 relA1] (Invitrogen, Carlsbad CA, USA) and then used for transforming the acrystalliferous strain of B. thuringiensis subsp. israelensis 4Q7, (hereafter 4Q7), and B. thuringiensis subsp. kurstaki HD1 (hereafter HD1) (Bacillus Genetic Stock Center, Columbus, OH). Plasmid pGLO is a vector that harbors the green fluorescent protein (gfp) gene under the control arabinose (araC) promoter and contains an ampicillin (bla) resistance gene marker (Bio-Rad, Hercules CA, USA). The shuttle vectors used to transform the different constructs in B. thuringiensis were the pHT3101 and the pSTAB, a pHT3101-derived vector containing cyt1A- p/STAB-SD (17), both harbor erythromycin and ampicillin resistance gene markers [27].
Construction of recombinant plasmids
ChiA74 without the signal peptide sequence under control of the wildtype promoter (chiA74Δsp-wp) or the cyt1A-p/STAB-SD system (chiA74Δsp-cyt1A-p/STAB-SD)
Recombinant plasmid pEHchiA74 and pEBchiA74 harboring the chiA74 under the control of the wild promoter and the pcytA-p/ STAB-SD, were used as templates, respectively. Two primers (chiA74-13 F and chiA74-12R) were designed to amplify chiA74 without the signal peptide-encoding sequence (i.e., codons 1–34 deleted). ChiA74-13 F contains an artificial Sac II site at the 5′ end, an artificial ATG translation initiation codon in frame with the remaining sequence of chiA74 (starting with the codon for Ser-35). ChiA74-12 F contains an artificial Sac I site in the 5′ of the lower strand and was used to amplify chiA74 (Figure 1A, Table 1). PCR amplification was performed with the Phusion High-Fidelity DNA Polymerase (Finnzymes, Finland) in a C1000 Touch Thermal Cycler (Bio-Rad, Hercules, CA, USA). Amplicons were purified using the QIAquick gel extraction kit (Qiagen, Valencia, CA, USA), treated with T4 polynucleotide kinase (New England BioLabs, Beverly, MA) and then ligated with T4 DNA ligase (New England BioLabs, Beverly, MA). Deletion of the signal peptide-encoding sequence was confirmed by PCR and nucleotide sequencing of the recombinant plasmids. Recombinant plasmids harboring the chiA74Δsp-wp or the chiA74Δsp-cyt1A- p/STAB-SD were designated as pEHchiA74Δsp and pEBchiA74Δsp, respectively.
chiA74Δsp-GFP fusion
The open reading frame coding for the green fluorescent protein (gfp) was amplified from the pGLO vector using the gfp-1 and gfp-3 primers (see list of primers in Table 1). PCR amplification was performed with the Phusion High-Fidelity DNA Polymerase (Finnzymes, Finland). In addition, chiA74Δsp, lacking the stop codon, under the control of the wild or cytA-p promoters was amplified from pEHchiA74Δsp and pEBchiA74Δsp, respectively, using the primers chiA74-C (forward) and chiA74-B (reverse). Then the amplicons pEHchiA74Δsp, pEBchiA74Δsp and gfp were digested with Bgl II, ligated and then used to transform E. coli DH5α to obtain the chimeric constructs pEHchiA74Δsp-gfp and pEBchiA74Δsp-gfp (Figure 2A1). The fidelity of constructs was confirmed by restriction enzyme and PCR analyses using specific primers (Figure 2A2).
Transformation
Recombinant plasmids were introduced into E. coli DH5α using an E. coli pulser (BioRad) set at 2.5 kV, 200 Ω and 25 μF and transformants were selected on Luria-Bertani (LB) medium with ampicillin (100 μg mL-1) (10). 4Q7 and HD1 competent cells were prepared as described previously [28]. Approximately 3 μg of the recombinant plasmids were mixed with 300 μl of competent cell suspension, held on ice for 10 min followed by electroporation using a BTX ECM630 electro cell manipulator (San Diego CA, USA) set at 2.3 kV, 475 Ω and 25 μF. After the pulse, the suspension was added to 3 ml of brain heart infusion (BHI) (Bioxon México) and incubated with gentle shaking for 1 h at 37°C. Transformants were selected on BHI supplemented with 25 μg mL-1 of erythromycin.
Phase contrast and fluorescence microscopy
E. coli, 4Q7 and HD1 were cultivated in LB or nutrient broth at 37°C or 28°C (200 rpm), respectively. Samples were taken at different times and monitored by phase contrast and fluorescence microscopy. Data were obtained using an Axio Imager A.1 Zeiss microscope with the filter set at 09, an excitation of 450–490 nm, and an emission of 515 nm. Crystal area was estimated using the AxioVision LE program (Carl Zeiss Microscopy, Göttingen Germany).
Evaluation of the chitinase activity
To determine the level of endochitinase activity in preparations of E. coli- pEHchiA74∆sp, E. coli- pEBchiA74∆sp and 4Q7-pEBchiA74Δsp, 4Q7-pEBchiA74Δsp, bacteria were cultivated in LB with ampicillin (100 μg/ml) at 37°C, 200 rpm, or in nutrient broth with erythromycin (25 μg/ml) at 28°C, 200 rpm [16], respectively. Controls (E. coli and 4Q7) were grown without antibiotics. Cultures were centrifuged, washed three times with distilled water and resuspended in 100 mM phosphate buffer (pH 7.0). Cells were sonicated three times, 15 s each, at an amplitude of 40 Hz in a 20 kHz ultrasonic processor (Sonics and Materials, Inc). Samples were centrifuged and the pellets mixed with solubilization buffer (30 mM Na2CO3, 0.2% β-ME, 1 mM phenylmethylsulfonyl fluoride, pH 10–11 [11]. Suspensions were incubated at 37°C with gentle agitation for 40 min, centrifuged, and supernatants were assayed with the fluorogenic substrate 4-MU-(GlcNAc)3 at pH 6.8, in a Glomax Multi Jr. Detection System (Promega, Sunnyvale CA, USA), as previously described [29]. To determine chitinase activity of HD1 and HD1-pEBchiA74Δsp, bacteria were growth in 75 mL nutrient broth with or without erythromycin, respectively, and incubated at 28°C, 200 rpm to autolysis (~72 hr). To compare activity of the recombinant versus wildtype strain, 1 mL of each culture was centrifuged and the pellets were washed three times with distilled water and then resuspended in 150 μL of solubilization buffer. Samples were incubated at 37°C with gentle agitation for 40 min, centrifuged, and supernatants were assayed with the fluorogenic substrate 4-MU-(GlcNAc)3 at pH 6.8. In addition, activity at different pH of the alkaline-solubilized recombinant chitinase was determined. Approximately 74 mL of the remaining culture was centrifuged, washed with distilled water and resuspended in 5 mL of solubilization buffer. The enzymatic activity of concentrated ChiA74Δsp at a pH range of 4–10 was evaluated with the tetrameric fluorogenic derivative using a reaction buffer containing sodium acetate, MES [2 (N-morpholino) ethane sulfonic acid], NaH2PO4, Trizma base [Tris(hydroxymethyl) aminomethane] and glycine, with a final concentration of 15 mM for each component.
In addition, dissolved ChiA74Δsp samples were fractionated in a 12% polyacrylamide gel by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Afterwards proteins were renatured by removing SDS and 2-mercaptoethanol with casein-EDTA wash buffer (1% casein, 2 mM EDTA, 40 mM Tris–HCl, pH 9). Detection of chitinase activity was determined using 4-MU-(GlcNAc)3, as previously described [29].
Effect on viable spores count
Bacteria were growth in nutrient broth for 3 days at 28°C, 200 rpm. Then 100 μL of autolysed cultures were incubated at 60°C for 20 min to destroy remaining vegetative cells [16]. After serial dilution (10-5-10-6), suspensions were plated on nutrient agar with or without erythromycin and incubated at 28°C for 24 h to determine the number of viable spores. Data were analyzed with the ANOVA program (StatSoft Inc.).
Quantitative PCR (qPCR)
Total mRNA was obtained from 4Q7-pEHchiA74Δsp-gfp and 4Q7-pEBchiA74Δsp-gfp. One mL of each bacterial culture was harvested periodically from 2 h to 96 h, centrifuged and cells were resuspended in 1 mL of Trizol (Invitrogen, Carlsbad CA, USA). Samples were sonicated 15 s in an ultrasonic processor (Sonics and Materials, Inc), and RNA extraction was performed according to manufacturer’s protocol (Invitrogen, Carlsbad CA, USA). Total RNA was resuspended in 30 μL of double distilled water and DNA contamination was eliminated using DNAse I (Jena Bioscience, Jena Germany). Then 1 μg of total RNA was used to synthesize cDNA using the iScript cDNA synthesis kit according to the manufacturer’s instruction (Bio-Rad, Hercules CA, USA). For quantitative PCR, specific primers were used to amplify the erythromycin and green fluorescent protein gene (gfp). The erythromycin gene was used as internal control to normalize the RNA. As the chitinase gene in 4Q7 is amplified with the specific primer of chiA74 Δsp (data not shown), the gfp was employed to determine the relative amount of chiA74 Δsp mRNA in the recombinant bacteria because this gene was fused to the chiA74 Δsp. Quantitative PCR was carried out in the CFX connect Real time system (Bio-Rad, Hercules CA, USA). Reaction mixture contained 5 μL of SyBR green master mix, 0.4 mM of each primer and 40 μg/mL of total transcribed RNA. Thermal cycling conditions were: 95°C for 5 min, followed by 40 cycles of 95°C for 30 s and 55°C for 60 s. This was followed by a melting curve program of 65 to 95°C with a heating rate of 0.5°C per second. Data were analyzed by relative quantification using the ΔCT method (Bio-Rad, Hercules CA, USA).
Bioassays
Manduca sexta (Lepidotpera: Sphingidae) colonies were maintained on artificial diet [30] under laboratory conditions at 28 ± 2°C and 70 ± 10% relative humidity, under a 16:8 (light:dark) photoperiod. Strains were cultured in nutrient broth at 28°C, 200 rpm. Then sporulated and autolyzed cultures were centrifuged and supernatants were discarded to eliminate secreted molecules such as protease, endogenous chitinases and putative Vip proteins. Pellets (spore-Cry crystal mixtures of HD-1 and spore-Cry crystal-ChiA74Δsp inclusion mixtures of HD1- pEBchiA74∆sp) were washed three times with distilled water, lyophilized and powders were used for bioassays. Six different preparations of HD1 and HD1-pEBchiA74∆sp, and a tap water negative control, were assayed in triplicate. A constant volume of the sample dilution (250 μl) was applied onto the surface of diet contained in Petri dishes (area 60 cm2). Ten first instar larvae were added to each Petri dish and mortality was recorded after five days of incubation under laboratory conditions. The mean concentration at which 50% (LC50) of the larvae died was estimated by Probit analysis [31].
Declarations
Acknowledgements
This research was supported by Grant SEP-CONACYT (156682) México to J. E. Barboza-Corona. J. L. Delgadillo-Ángeles and L. E. Casados-Vázquez are a graduate student and a Postdoctoral researcher, respectively, and are supported by CONACyT, México. We thank Rubén Salcedo-Hernández from Universidad de Guanajuato and Jorge E. Ibarra, Javier Luévano-Borroel from CINVESTAV México, for their technical support during this study.
Authors’ Affiliations
References
- Park H-W, Federici BA, Sakano Y: Insecticidal protein crystals of Bacillus thuringiensis. Microbiology monographs: inclusions in prokaryotes, Volume 1. Edited by: Shively JM. 2006, 195-236. Heidelberg, Germany: Springer-Verlag, Google Scholar
- Wu D, Federici BA: A 20-kilodalton protein preserves cell viability and promotes CytA crystal formation during sporulation in Bacillus thuringiensis. J Bacteriol. 1993, 175: 5276-5280.Google Scholar
- Federici BA: Insecticidal bacteria: an overwhelming success for invertebrate pathology. J Invertebr Pathol. 2003, 89: 30-38.View ArticleGoogle Scholar
- Sanahuja G, Banakar R, Twyman RM, Capel T, Chrstou P: Bacillus thuringiensis: a century of research, development and commercial applications. Plant Biotechnol J. 2011, 9: 283-300. 10.1111/j.1467-7652.2011.00595.x.View ArticleGoogle Scholar
- Aronson A: Sporulation and d-endotoxin synthesis by Bacillus thuringiensis. Cell Mol Life Sci. 2002, 59: 417-425. 10.1007/s00018-002-8434-6.View ArticleGoogle Scholar
- Bietlot HPL, Vishmulhatla J, Carey PR, Pozsgay M, Kaplan H: Characterization of the cysteine residues and disulphide linkages in the protein crystal of Bacillus thuringiensis. Biochem J. 1999, 267: 309-315.View ArticleGoogle Scholar
- Chan L, Grant R, Aronson A: Regulation of the packaging of Bacillus thuringiensis Δ-endotoxins into inclusions. Appl Environ Microbiol. 2001, 67: 032-5036.Google Scholar
- Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH: Bacillus thuringiensis and its pesticidal crystals proteins. Microbiol Mol Biol Rev. 1998, 62: 775-806.Google Scholar
- Casique-Arroyo G, Bideshi D, Salcedo-Hernández R, Barboza-Corona JE: Development of a recombinant strain of Bacillus thuringiensis subsp. kurstaki HD-73 that produces the endochitinase ChiA74. Antonie Van Leeuwenhoek. 2007, 92: 1-9. 10.1007/s10482-006-9127-1.View ArticleGoogle Scholar
- Castañeda-Ramírez C, De la Fuente-Salcido NM, Salcedo-Hernández R, León-Galván F, Bideshi DK, Barboza-Corona JE: High-level synthesis of endochitinase ChiA74 in Escherichia coli K12 and its promising potential for use in biotechnology. Folia Microbiologica. 2013, 58: 455-462. 10.1007/s12223-013-0229-7.View ArticleGoogle Scholar
- Hu SB, Liu P, Ding XZ, Yan L, Sun YJ, Zhang YM, Li WP, Xia LQ: Efficient constitutive expression of chitinase in the mother cell of Bacillus thuringiensis and its potential to enhance the toxicity of Cry1Ac protoxin. Appl Microbiol Biotechnol. 2009, 82: 1157-1167. 10.1007/s00253-009-1910-2.View ArticleGoogle Scholar
- Kuzu SB, Güvenmez HK, Denizci AA: Production of a thermostable and alkaline chitinase by Bacillus thuringiensis subsp. kurstaki strain HBK-51. Biotechnol Res Int. 2012: Article ID 135498. doi:10.1155/2012/135498. 10.1155/2012/135498..Google Scholar
- Thamthiankul S, Moar WJ, Miller ME, Panbangred W: Improving the insecticidal activity of Bacillus thuringiensis subsp aizawai against Spodoptera exigua by chromosomal expression of a chitinase gene. Appl Microbiol Biotechnol. 2004, 65: 183-192.View ArticleGoogle Scholar
- Ding X, Luo Z, Xia L, Gao B, Sun Y, Zhang Y: Improving the insecticidal activity by expression of a recombinant cry1Ac gene with chitinase-encoding gene in acrystalliferous Bacillus thuringiensis. Curr Microbiol. 2008, 56: 442-446. 10.1007/s00284-008-9112-1.View ArticleGoogle Scholar
- Driss F, Rouis S, Azzouz H, Tounsi S, Zouari N, Jaoua S: Integration of a recombinant chitinase into Bacillus thuringiensis parasporal insecticidal crystal. Curr Microbiol. 2011, 62: 281-288. 10.1007/s00284-010-9704-4.View ArticleGoogle Scholar
- Barboza-Corona JE, Ortiz-Rodríguez T, de la Fuente-Salcido N, Ibarra J, Bideshi DK, Salcedo-Hernández R: Hyperproduction of chitinase influences crystal toxin synthesis and sporulation of Bacillus thuringiensis. Antonie Van Leeuwenhoek. 2009, 96: 31-42. 10.1007/s10482-009-9332-9.View ArticleGoogle Scholar
- Park HW, Ge B, Bauer LS, Federici BA: Optimization of Cry3A yields in Bacillus thuringiensis by use of sporulation-dependent promoters in combination with the STAB-SD mRNA sequence. Appl Environ Microbiol. 1998, 64: 3932-3938.Google Scholar
- Coquel AN, Jacob JP, Primet M, Demarez A, Dimiccoli M, Julou T, Moisan L, Lindner AB, Berry H: Localization of protein aggregation in Escherichia coli is governed by diffusion and nucleoid macromolecular crowding effect. PLoS Comput Biol. 2013, 9 (4): e1003038- 10.1371/journal.pcbi.1003038.View ArticleGoogle Scholar
- Buasri W, Panbangred W: Large crystal toxin formation in chromosomally engineered Bacillus thuringiensis subsp. aizawai due to σE accumulation. Appl Environ Microbiol. 2012, 78: 1682-1691. 10.1128/AEM.06505-11.View ArticleGoogle Scholar
- Cai Y, Yan J, Hu X, Han B, Zhiming Yuan Z: Improving the insecticidal activity against resistant Culex quinquefasciatus mosquitoes by expression of chitinase gene chiAC in Bacillus sphaericus. Appl Environ Microbiol. 2007, 73: 7744-7746. 10.1128/AEM.01510-07.View ArticleGoogle Scholar
- Ozgen A, Sezen K, Demir I, Demirbag Z, Nalcacioglu R: Molecular characterization of chitinase genes from a local isolate of Serratia marcescens and their contribution to the insecticidal activity of Bacillus thuringiensis strains. Curr Microbiol. 2013, 67: 499-504.View ArticleGoogle Scholar
- Smirnoff WA: Effect of chitinase on the action of Bacillus thuringiensis. Can Entomol. 1971, 12: 1829-1831.View ArticleGoogle Scholar
- Tang Y, Tong J, Zhang Y, Wang L, Hu S, Li W, Lv W: Preliminary comparing the toxicities of the hybrid cry1Ac s fused with different heterogenous genes provided guidance for the fusion expression of Cry proteins. World J Microbiol Biotechnol. 2012, 28: 397-400. 10.1007/s11274-011-0825-0.View ArticleGoogle Scholar
- Fujita M, González-Pastor JE, Losick R: High-and low-threshold genes in the Spo0A regulon of Bacillus subtilis. J Bacteriol. 2005, 187: 1357-1368. 10.1128/JB.187.4.1357-1368.2005.View ArticleGoogle Scholar
- Fujita M, Losick R: Evidence that entry into sporulation in Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulon Spo0A. Genes Dev. 2005, 19: 2236-2244. 10.1101/gad.1335705.View ArticleGoogle Scholar
- Down JAT: pH gradients in lepidopteran midgut. J Exp Biol. 1992, 172: 355-375.Google Scholar
- Barboza-Corona JE, Park HW, Bideshi DK, Federici BA: The 60-kilodalton protein encoded by orf2 in the cry19A operon of Bacillus thuringiensis subsp. jegathesan functions like a C-terminal crystallization domain. Appl Environ Microbiol. 2012, 78: 2005-2012. 10.1128/AEM.06750-11.View ArticleGoogle Scholar
- Park HW, Bideshi DK, Wirth MC, Johnson JJ, Walton WE, Federici BA: Recombinant larvicidal bacteria with markedly improved efficacy against Culex vectors of West Nile virus. Am J Trop Med Hyg. 2005, 72: 732-738.Google Scholar
- Barboza-Corona JE, Nieto-Mazzocco E, Velázquez-Robledo R, Salcedo-Hernández R, Bautista M, Jiménez B, Ibarra JE: Cloning, sequencing and expression of the chitinase gene chiA74 from Bacillus thuringiensis. Appl Environ Microbiol. 2003, 69: 1023-1029. 10.1128/AEM.69.2.1023-1029.2003.View ArticleGoogle Scholar
- Bell RA, Joachim FG: Techniques for rearing laboratory colonies of tobacco hornworm and pink bollworms. Ann Entomol Soc Am. 1976, 69: 365-373.View ArticleGoogle Scholar
- Ibarra JE, Federici BA: An alternative bioassay for determining the toxicity of suspended particles to mosquito larvae. J Am Mosq Control Assoc. 1987, 3: 187-192.Google Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.