Skip to content

Advertisement

Open Access

Re-annotation of the CAZy genes of Trichoderma reesei and transcription in the presence of lignocellulosic substrates

  • Mari Häkkinen1Email author,
  • Mikko Arvas1,
  • Merja Oja1,
  • Nina Aro1,
  • Merja Penttilä1,
  • Markku Saloheimo1 and
  • Tiina M Pakula1
Microbial Cell Factories201211:134

https://doi.org/10.1186/1475-2859-11-134

Received: 29 June 2012

Accepted: 22 September 2012

Published: 4 October 2012

Abstract

Background

Trichoderma reesei is a soft rot Ascomycota fungus utilised for industrial production of secreted enzymes, especially lignocellulose degrading enzymes. About 30 carbohydrate active enzymes (CAZymes) of T. reesei have been biochemically characterised. Genome sequencing has revealed a large number of novel candidates for CAZymes, thus increasing the potential for identification of enzymes with novel activities and properties. Plenty of data exists on the carbon source dependent regulation of the characterised hydrolytic genes. However, information on the expression of the novel CAZyme genes, especially on complex biomass material, is very limited.

Results

In this study, the CAZyme gene content of the T. reesei genome was updated and the annotations of the genes refined using both computational and manual approaches. Phylogenetic analysis was done to assist the annotation and to identify functionally diversified CAZymes. The analyses identified 201 glycoside hydrolase genes, 22 carbohydrate esterase genes and five polysaccharide lyase genes. Updated or novel functional predictions were assigned to 44 genes, and the phylogenetic analysis indicated further functional diversification within enzyme families or groups of enzymes. GH3 β-glucosidases, GH27 α-galactosidases and GH18 chitinases were especially functionally diverse. The expression of the lignocellulose degrading enzyme system of T. reesei was studied by cultivating the fungus in the presence of different inducing substrates and by subjecting the cultures to transcriptional profiling. The substrates included both defined and complex lignocellulose related materials, such as pretreated bagasse, wheat straw, spruce, xylan, Avicel cellulose and sophorose. The analysis revealed co-regulated groups of CAZyme genes, such as genes induced in all the conditions studied and also genes induced preferentially by a certain set of substrates.

Conclusions

In this study, the CAZyme content of the T. reesei genome was updated, the discrepancies between the different genome versions and published literature were removed and the annotation of many of the genes was refined. Expression analysis of the genes gave information on the enzyme activities potentially induced by the presence of the different substrates. Comparison of the expression profiles of the CAZyme genes under the different conditions identified co-regulated groups of genes, suggesting common regulatory mechanisms for the gene groups.

Keywords

Carbohydrate active enzymesCellulaseHemicellulaseLignocelluloseTranscriptomeTranscriptional profilingGene regulationWheatSpruceBagasseBiorefinery

Background

Natural resources are diminishing while the demand for commodities, energy and food increases. This sets a requirement to find solutions for efficient utilisation of renewable biological material in production of energy and chemicals. The most abundant terrestrial renewable organic resource is lignocellulose that can be derived from industrial side-streams, municipal waste, or by-products of agriculture and forestry, and can be used as a raw material in biorefinery applications (for reviews, see [1] and [2]). It consists of cellulose, hemicellulose and lignin. Cellulose is a polymer of β-1,4-linked D-glucose units. Hemicelluloses are more heterogeneous materials that can be classified as xylans, mannans, xyloglucans and mixed-linkage glucans according to the main sugar units forming the backbone. In addition, hemicelluloses are often branched and contain side chains such as galactose, arabinan, glucuronic acid and acetyl groups. Lignin is a very resistant material that lacks a precise structure and consists of aromatic building-blocks [3]. Typically, conversion of biomass raw material includes physical and chemical pre-treatment followed by enzymatic hydrolysis of the polymers into monosaccharides and fermentation of the sugars by micro-organisms to produce higher value products, such as transport fuels and chemical feedstocks [1]. Due to the complex and heterogeneous nature of the material, both the pre-treatment method and the enzyme composition need to be adjusted according to the type of the raw material. Since the cost of enzymes is still a major limitation in the utilisation of biomass, improvement of the enzyme production systems and use of optimal mixtures of synergistic enzymes, as well as the choice of raw material and pretreatment method, are of importance in setting up a cost effective biorefinery process [4].

The CAZy database [5, 6] contains information on carbohydrate active enzymes involved in breakdown, modification and synthesis of glycosidic bonds. Enzyme classes covered by CAZy classification include glycoside hydrolases (GH), carbohydrate esterases (CE), polysaccharide lyases (PL) and glycosyltransferases (GT). In addition, enzymes containing a carbohydrate binding module (CBM) are also covered. Enzymes are further classified into different families, originally based on hydrophobic cluster analysis and later on utilising sequence similarity analyses supplemented by structural information together with experimental evidence available in scientific literature. Enzymes degrading lignocellulosic plant cell wall material are known to be especially abundant in glycoside hydrolase and carbohydrate esterase families.

Trichoderma reesei (anamorph of Hypocrea jecorina), a mesophilic soft-rot of the phylum Ascomycota, is known for its ability to produce high amounts of cellulases and hemicellulases. It is widely employed to produce enzymes for applications in pulp and paper, food, feed and textile industries and, currently, with increasing importance in biorefining [7]. T. reesei produces two exo-acting cellobiohydrolases (CBHI/CEL7A and CBHII/CEL6A) [810]. Five endo-acting cellulases (EGI/CEL7B, EGII/CEL5A, EGIII/CEL12A, EGIV/CEL61A, EGV/CEL45A) [1115] have been characterized, and three putative endoglucanases (CEL74A, CEL61B and CEL5B) have been found using cDNA sequencing [16]. From these enzymes CEL74A has been later characterized as a putative xyloglucanase [17], and enzymes of the glycoside hydrolase family GH61 have been shown to enhance lignocellulose degradation by an oxidative mechanism [18]. The T. reesei genome also encodes two characterized β-glucosidases (BGLI/CEL3A and BGLII/CEL1A) [1922] and five predicted β-glucosidases (CEL3B, CEL3D, CEL1B, CEL3C, CEL3E) [16]. β-glucosidases hydrolyse non-reducing β-D-glucosyl residues in oligomeric cellulose degradation products and carry out transglycosylation reactions of them. Swollenin (SWOI) participates in the degradation of biomass by disrupting crystalline cellulose structure without apparent release of sugars [23]. Hemicellulases produced by T. reesei include four xylanases (XYNI, XYNII, XYNIII and XYNIV) [2426], a mannanase (MANI) [27], one characterized (AXEI) [28] and one predicted (AXEII) acetyl xylan esterase [16], α-glucuronidase (GLRI) [29], one characterized (ABFI) [30] and two predicted (ABFII, ABFIII) arabinofuranosidases [16, 31], three α-galactosidases (AGLI, AGLII and AGLIII) [32, 33] as well as a β-xylosidase (BXLI) [30] that digests oligosaccharides derived from xylan. An acetyl esterase gene (AESI) that removes acetyl groups from hemicellulose has also been identified [34]. Glucuronoyl esterase CIPII is believed to participate in the degradation of lignocellulose biomass by cleaving ester linkages between lignin and hemicellulose and so facilitating the removal of lignin [16, 35, 36]. In addition to the characterized genes, several novel candidate lignocellulose degrading enzymes have been identified from the genome of T. reesei based on conserved domains and homology to enzymes from other fungi [37, 38].

The majority of the characterised cellulase and hemicellulase genes of T. reesei are regulated by the type of carbon source available, in order to ensure production of hydrolytic enzymes required for degradation of the substrate and, on the other hand, to avoid energy consuming enzyme production under conditions where easily metabolisable carbon source is available. In most cases, the genes encoding the hydrolytic enzymes are repressed by glucose, and induced by various compounds derived from plant cell wall material (for reviews, see [3941]) or their metabolic derivatives. Cellulase and hemicellulase genes have been shown to be induced e.g. in the presence of cellulose, β-glucan, xylans and a variety of mono- and disaccharides, such as lactose, cellobiose, sophorose, L-sorbose, L-arabitol, xylobiose, cellobiose and galactose, different sets of genes being induced by the different compounds [16, 4246]. However, information on the co-induced gene groups on different substrates is still rather limited, especially regarding the novel candidate glycoside hydrolase genes identified from the genome sequence.

In this study, we have used computational methods and phylogenetic analysis to update the annotation and functional prediction of the CAZymes of T. reesei. Furthermore, we have analysed the expression of the CAZyme genes of T. reesei in the presence of different lignocellulose materials as inducing substrates in order to identify co-regulated gene groups, and to get information on the enzyme activities induced by the presence of the substrates. The selected substrates included both purified compounds and polymeric carbohydrates as well as complex lignocellulosic raw materials. The information was used to identify co-regulated gene groups and sets of genes induced by the substrates.

Results

Identification of T. reesei CAZyme genes

We have updated the existing annotations of CAZyme genes of T. reesei using computational methods and manual proofreading in order to remove discrepancies between annotations in the different genome versions [38, 47] and published literature. We have also used comparative genomics and phylogenetic information to update and refine functional prediction of the encoded enzymes. The initial set of candidates for T. reesei CAZymes was identified by mapping the T. reesei proteome to CAZy database [5, 6] using blastp [48], and a preliminary function prediction was assigned for the candidates based on the homologues (Additional file 1). After removal of candidates with blast hits that had apparently incorrect annotation and genes with other function predictions not related to CAZy, a total of 387 candidate genes were retrieved. Glycosyltransferase genes (99 GT genes) and the carbohydrate esterase family 10 genes (31 CE genes) were excluded from the further study since these genes mostly encode activities not involved in degradation of plant cell wall material. Furthermore, the CE10 family is no longer updated in the CAZy database. In order to verify whether the selection of candidate genes for CAZymes was supported by protein sequences from other fungi, the protein homology clusters described in [49] and updated to include 49 fungal species [50], were mapped to the CAZy database. The homology clusters were then filtered based on the average sequence identity percentage and length of the blast alignment with CAZymes (Additional file 2B and C). The clusters containing CAZymes were manually reviewed for consistency of protein domain content and quality of gene models to get reliable candidates. In addition, a few genes not fulfilling all the computational criteria were included in the further study. The proteins encoded by T. reesei genes 59791 and 73101 were found in protein homology clusters with no other members. The phylogeny of these two genes is discussed later. The gene 22129 was included in the study due to its previous annotation as distantly related to GH61 family [38]. In total 228 CAZyme genes remained after the computational and manual filtering.

Functional diversification of T. reesei CAZyme genes

CAZy family membership was assigned to the T. reesei gene products based on the CAZy family members of other species in the same protein homology cluster (clustering of the 49 fungal species) by majority vote. The homology clusters typically corresponded to groups of orthologous gene products supplemented with paralogues derived from gene duplications that have occurred in some sub lineage of the 49 species. T. reesei CAZymes were predicted to belong to 61 CAZy families (excluding CE10). The members of 27 CAZy families were divided into more than one protein homology clusters (Table 1). The fact that a family was divided into several clusters was interpreted as a sign of functional diversification within the family. In Saccharomyces cerevisiae most duplicated genes are derived from the genome duplication event that took place approximately 100 million years ago [51, 52]. Recently, it has been experimentally shown that these duplicates have diverged in cellular, if not molecular, functions [53]. Sordariomycetes diverged from other fungi roughly 400 million years ago hence it is safe to assume that duplicate genes that were likely to exist already in the common ancestor of Sordariomycetes have had ample time to diverge functionally [54]. Thus, each protein homology cluster with multiple T. reesei CAZymes was searched for signs of further functional diversification within the cluster. If the phylogenetic analysis of a homology cluster suggested that the gene duplication predated the common ancestor of Sordariomycetes, it was interpreted as a sign of functional diversification between the T. reesei gene duplicates (Table 1).
Table 1

CAZyme genes of T. reesei

Gene IDa

Nameb

CAZyc

Annotation

CBM moduled

Refe

Prot. clusterf

Functional subgroupg

A.

107268

 

CE1

Cand. S-formylglutathione hydrolase

 

This study

2607

2607a

72072

 

CE1

Cand. esterase

 

[38]

6197

6197a

107850

 

CE1

Cand. esterase

 

[47]

6197

6197a

44366

 

CE3

Cand. esterase

 

This study

2806

2806a

70021

 

CE3

Cand. acetyl xylan esterase

 

[38]

2806

2806a

41248

 

CE3

Cand. acetyl xylan esterase

 

[47]

6113

6113a

107488

 

CE3

Cand. esterase

 

This study

6113

6113a

31227

 

CE3

Cand. esterase/suberinase

 

This study

13836

13836a

67678

 

CE4

Cand. chitin deacetylase

CBM18

[37]

302

302a

69490

 

CE4

Cand. chitin deacetylase

CBM18

[37]

302

302b

65215

 

CE4

Cand. imidase

 

[38]

2445

2445a

105072

 

CE4

Cand. polysaccharide deacetylase

 

[38], A

4972

4972a

60489

 

CE5

Cand. cutinase

 

[38]

540

540a

44214

axe2

CE5

Cand. acetyl xylan esterase

 

[16]

865

865a

54219

 

CE5

Cand. acetyl xylan esterase

 

[31]

865

865b

73632

axe1

CE5

Acetyl xylan esterase

CBM1

[28]

865

865b

79671

 

CE9

Cand. N-acetyl-glucosamine-6-phosphate deacetylase

 

[38]

2516

2516a

3101

 

CE14

Cand. N-acetylglucosaminylphosphatidylinositol de-N-acetylase

 

This study

2076

2076a

58550

 

CE14

Cand. N-acetylglucosaminylphosphatidylinositol de-N-acetylase

 

This study

7267

7267a

123940

cip2

CE15

Glucuronoyl esterase

 

[16]

4243

4243a

103825

 

CE16

Cand. acetyl esterase

 

This study

3851

3851a

121418

aes1

CE16

Acetyl esterase

 

[34]

3851

3851a

22197

cel1b

GH1

Cand. β-glucosidase

 

[16]

662

662a

120749

bgl2/cel1a

GH1

β-glucosidase

 

[21]

662

662b

5836

 

GH2

Cand. β-mannosidase

 

[38]

609

609a

59689

 

GH2

Cand. β-mannosidase

 

[38]

609

609a

69245

 

GH2

Cand. β-mannosidase

 

[38]

609

609a

62166

 

GH2

Cand. β-mannosidase

 

[38]

609

609b

57857

 

GH2

Cand. β-mannosidase

 

[38], A

609

609c

77299

gls93

GH2

Exo-β-D-glucosaminidase

 

[83]

2917

2917a

76852

 

GH2

Cand. β-galactosidase/β-glucuronidase

 

[38], A

4433

4433a

102909

 

GH2

Cand. GH2 protein

 

This study

125855

125855a

121735

cel3b

GH3

Cand. β-glucosidase

 

[16]

110

110a

47268

bgl3i

GH3

Cand. β-glucosidase

 

[62]

110

110b

66832

 

GH3

Cand. β-glucosidase

 

[37]

110

110c

76227

cel3e

GH3

Cand. β-glucosidase

 

[16]

110

110d

76672

bgl1/cel3a

GH3

β-glucosidase

 

[22]

110

110e

104797

bgl3j

GH3

Cand. β-glucosidase

 

[62]

110

110f

46816

cel3d

GH3

Cand. β-glucosidase

 

[16]

132

132a

82227

cel3c

GH3

Cand. β-glucosidase

 

[16]

132

132b

108671

bgl3f

GH3

Cand. β-glucosidase/glucan 1,4-β-glucosidase

 

[62], A

132

132c

69557

 

GH3

Cand. β-N-acetylglucosaminidase

 

[38], A

2317

2317a

79669

 

GH3

Cand. β-N-acetylglucosaminidase

 

[38], A

2317

2317b

58450

xyl3b

GH3

Cand. β-xylosidase

 

[62]

3274

3274a

121127

bxl1

GH3

β-xylosidase

 

[30]

3274

3274b

64375

 

GH5

Cand. glucan β-1,3-glucosidase

 

[38]

173

173a

64906

 

GH5

Cand. endo-β-1,6-glucanase

 

[38]

173

173b

77506

cel5d

GH5

Cand. β-glycosidase

 

[62]

732

732a

82616

cel5b

GH5

Cand. membrane bound endoglucanase

 

[16]

778

778a

120312

egl2/cel5a

GH5

Endo-β-1,4-glucanase

CBM1

[15]

778

778a

56996

man1

GH5

β-Mannanase

CBM1

[27]

1854

1854a

53731

 

GH5

Cand. endo-β-1,4-glucanase

 

[37]

8196

8196a

71554

 

GH5

Cand. β-1,3-mannanase/endo-β-1,4-mannosidase

 

[38], A

16589

16589a

72567

cbh2/cel6a

GH6

Cellobiohydrolase

CBM1

[10]

2966

2966a

122081

egl1/cel7b

GH7

Endo-β-1,4-glucanase

CBM1

[11]

470

470a

123989

cbh1/cel7a

GH7

Cellobiohydrolase

CBM1

[8]

470

470b

120229

xyn3

GH10

Endo-β-1,4-xylanase

 

[26]

429

429a

74223

xyn1

GH11

Endo-β-1,4-xylanase

 

[24]

643

643a

112392

xyn5

GH11

Cand. endo-β-1,4-xylanase

 

[58]

643

643a

123818

xyn2

GH11

Endo-β-1,4-xylanase

 

[24]

643

643b

123232

egl3/cel12a

GH12

Endo-β-1,4-glucanase

 

[12]

1708

1708a

77284

 

GH12

Cand. endo-β-1,4-glucanase

 

[38], A

7857

7857a

59578

 

GH13

Cand. α-glucosidase

 

[38]

316

316a

108477

 

GH13

Cand. α-glucosidase/oligo α-glucosidase

 

[38]

316

316b

105956

 

GH13

Cand. α-amylase

 

[38]

394

394a

57128

 

GH13

Cand. glycogen debranching enzyme

 

[38]

1465

1465a

123368

 

GH13

Cand. 1,4-α-glucan branching enzyme

 

[38]

1522

1522a

B.

1885

gla

GH15

Glucoamylase

 

[84]

608

608a

65333

 

GH15

Cand. α-glycosidase (Glucoamylase and related glycosyl hydrolases)

 

[38], A

3601

3601a

121294

 

GH16

Cand. glucan endo-1,3(4)-β-D-glucosidase

 

[38]

169

169a

38536

 

GH16

Cand. glucan endo-1,3(4)-β-D-glucosidase

 

[38]

169

169b

49274

 

GH16

Cand. glucan endo-1,3(4)-β-D-glucosidase

 

[37]

169

169c

55886

 

GH16

Cand. glucan endo-1,3(4)-β-D-glucosidase

 

[38], A

169

169c

41768

 

GH16

Cand. cell wall glucanosyltransferase

 

[37], A

248

248

58239

 

GH16

Cand. cell wall glucanosyltransferase

 

[37], A

248

248a

66843

 

GH16

Cand. cell wall glucanosyltransferase

 

[47], A

248

248b

65406

 

GH16

Cand. cell wall glucanosyltransferase

 

[37], A

248

248c

50215

 

GH16

Cand. endo-1,3-β-D-glucosidase/1,3-glucan binding protein

 

[38], A

1176

1176a

76266

 

GH16

Cand. cell wall glucanosyltransferase

CBM18

[38], A

2089

2089a

122511

 

GH16

Cand. glucan endo-1,3(4)-β-D-glucosidase

 

[38]

2996

2996a

123726

 

GH16

Cand. glucan endo-1,3(4)-β-D-glucosidase

 

[38]

2996

2996a

39755

 

GH16

Cand. glucan endo-1,3(4)-β-D-glucosidase

 

[38], A

3545

3545a

70542

 

GH16

Cand. b-glycosidase (endo-beta-1,3(4)-β-D-glucanase)

 

[38], A

6108

6108a

71399

 

GH16

Cand. endo-1,3-β-glucanase

 

[38], A

9096

9096a

73101

 

GH16

Cand. glucan endo-1,3-1,4-β-D-glucosidase

 

[38], A

125817

125817a

49193

 

GH17

Cand. glucan 1,3-β-glucosidase

 

[38], A

536

536a

76700

 

GH17

Cand. glucan 1,3 β-glucosidase/ glucan endo-1,3-β-glucosidase

 

[38], A

2531

2531a

39942

 

GH17

Cand. glucan endo-1,3-β-glucosidase

 

[38]

2892

2892a

66792

 

GH17

Cand. glucan endo-1,3-β-glucosidase

 

[38], A

2892

2892b

59082

chi18-2

GH18

Cand. chitinase

 

[59]

115

115a

62704

chi18-3

GH18

Cand. chitinase

 

[59]

115

115a

2735

chi18-6

GH18

Cand. chitinase

 

[59]

115

115b

80833

chi46

GH18

Chitinase

 

[85]

115

115b

81598

chi18-7

GH18

Cand. chitinase

 

[59]

115

115c

56894

chi18-10

GH18

Cand. chitinase

CBM18

[59]

200

200a

108346

chi18-8

GH18

Cand. chitinase

CBM18

[59]

200

200b

53949

chi18-1

GH18

Cand. chitinase

CBM18

[59]

200

200c

72339

chi18-9

GH18

Cand. chitinase

CBM18

[59]

200

200d

119859

chi18-13

GH18

Cand. chitinase

 

[59]

410

410

43873

chi18-12

GH18

Cand. chitinase

 

[59]

410

410a

110317

chi18-17

GH18

Cand. chitinase

CBM1

[59]

410

410a

68347

chi18-16

GH18

Cand. chitinase

CBM1

[59]

410

410b

124043

chi18-14

GH18

Cand. chitinase

CBM1

[59]

410

410b

66041

chi18-18

GH18

Cand. chitinase

 

[59]

410

410c

65162

Endo T

GH18

Endo-N-acetyl-β-D-glucosaminidase

 

[86]

3445

3445a

121355

chi18-rel2

GH18

Cand. Endo-N-acetyl-β-D-glucosaminidase

 

[38], A

3445

3445a

56448

chi18-11

GH18

Cand. chitinase

 

[59]

3553

3553a

62645

chi18-4

GH18

Cand. chitinase

 

[59]

3553

3553a

59791

chi18-15

GH18

Cand. chitinase

 

[59]

125792

125792a

21725

 

GH20

Cand. exochitinase

 

[38]

1025

1025a

23346

nag2

GH20

Cand. exochitinase

 

[38]

1025

1025a

105931

 

GH20

Cand. N-acetyl-β-hexosaminidase

 

[38]

4197

4197a

109278

 

GH24

Cand. lysozyme

 

[38]

3728

3728a

103458

 

GH25

Cand. N,O-diacetylmuramidase

 

[38]

5086

5086a

55999

 

GH27

Cand. α-galactosidase

 

[58]

617

617a

65986

 

GH27

Cand. α-galactosidase

 

[38]

617

617a

72632

agl1

GH27

α-galactosidase

 

[32]

617

617b

27219

 

GH27

Cand. α-galactosidase

 

[38]

12458

12458a

27259

 

GH27

Cand. α-galactosidase

 

[38]

12458

12458a

59391

 

GH27

Cand. α-galactosidase

 

[38]

12458

12458a

72704

agl3

GH27

α-galactosidase

 

[32]

12458

12458a

75015

 

GH27

Cand. α-galactosidase

 

[38]

12458

12458a

70186

 

GH28

Cand. polygalacturonase/xylogalacturonan hydrolase

 

[38]

295

295a

112140

pgx1

GH28

Cand. exo-polygalacturonase

 

[58]

295

295b

122780

rgx1

GH28

Cand. exo-rhamnogalacturonase

 

[58]

295

295c

103049

 

GH28

Cand. endo-polygalacturonase

 

[38]

870

870a

69276

 

GH30

Cand. endo-β-1,4-xylanase

 

[38]

6176

6176a

111849

xyn4

GH30

Endo-β-1,4-xylanase

 

[87]

6176

6176a

3094

 

GH30

Cand. glucan endo 1,6-β-glucanase

 

[38]

7813

7813a

69736

 

GH30

Cand. glucan endo 1,6-β-glucanase

 

[38]

7813

7813a

110894

 

GH30

Cand. endo-β-1,6-galactanase

 

[38]

16621

16621a

82235

 

GH31

Cand. α-glucosidase

 

[38]

594

594a

121351

gls2

GH31

Glucosidase II alpha subunit

 

[88]

1379

1379a

69944

 

GH31

Cand. α-xylosidase/α-glucosidase

 

[38]

3846

3846a

60085

 

GH31

Cand. α-glucosidase

 

[38]

5176

5176a

80240

bga1

GH35

β-galactosidase

 

[89]

675

675a

64827

 

GH36

Cand. raffinose synthase domain protein

 

[38], A

3772

3772a

124016

agl2

GH36

α-galactosidase

 

[32]

4771

4771a

120676

 

GH37

Cand. α,α-trehalase

 

[38]

769

769a

123226

 

GH37

Cand. α,α-trehalase

 

[38]

4723

4723a

3196

 

GH38

Cand. α-mannosidase

 

[38]

1337

1337a

73102

 

GH39

Cand. β-xylosidase

 

[38], A

4388

4388a

3739

 

GH43

Cand. β-xylosidase/α-L-arabinofuranosidase

 

[38]

586

586a

68064

 

GH43

Cand. β-xylosidase/α-L-arabinofuranosidase

 

[47]

7306

7306a

49976

egl5/cel45a

GH45

Endo-β-1,4-glucanase

CBM1

[14]

12601

12601a

C.

45717

mds1

GH47

α-1,2-mannosidase

 

[90]

70

70a

2662

 

GH47

Cand. α-1,2-mannosidase

 

[38]

70

70b

111953

 

GH47

Cand. α-1,2-mannosidase

 

[38]

70

70c

79960

 

GH47

Cand. α-1,2-mannosidase

 

[47]

70

70d

65380

 

GH47

Cand. α-1,2-mannosidase

 

[38]

70

70e

79044

 

GH47

Cand. α-1,2-mannosidase

 

[38]

70

70e

22252

 

GH47

Cand. α-1,2-mannosidase

 

[37]

70

70f

64285

 

GH47

Cand. α-mannosidase

 

[38]

1421

1421a

55319

abf3

GH54

Cand. α-L-arabinofuranosidase

CBM42

[31]

5126

5126a

123283

abf1

GH54

α-L-arabinofuranosidase I

CBM42

[30]

5126

5126a

121746

gluc78

GH55

Cand. exo-1,3-β-glucanase

 

[58]

235

235a

54242

 

GH55

Cand. β-1,3-glucanase

 

[38]

235

235b

70845

 

GH55

Cand. β-1,3-glucanase

 

[38]

235

235b

108776

 

GH55

Cand. β-1,3-glucanase

 

[38]

235

235b

56418

 

GH55

Cand. β-1,3-glucanase

 

[38]

235

235c

73248

 

GH55

Cand. exo-1,3-β-glucanase

 

[38]

235

235d

73643

egl4/cel61a

GH61

Cand. copper-dependent polysaccharide monooxygenase/endo-β-1,4-glucanase

CBM1

[13]

77

77a

120961

cel61b

GH61

Cand. copper-dependent polysaccharide monooxygenase

 

[16]

77

77b

22129

 

GH61

Cand. copper-dependent polysaccharide monooxygenase

 

[38]

515

515a

31447

 

GH61

Cand. copper-dependent polysaccharide monooxygenase

 

This study

515

515b

76065

 

GH61

Cand. copper-dependent polysaccharide monooxygenase

 

This study

515

515b

27554

 

GH61

Cand. copper-dependent polysaccharide monooxygenase

 

[31]

8230

8230a

76210

abf2

GH62

Cand. α-L-arabinofuranosidase

 

[16]

3103

3103a

22072

 

GH63

Cand. processing α-glucosidase

 

[38]

1244

1244a

75036

 

GH63

Cand. α-glucosidase

 

[38], A

2428

2428a

65137

 

GH64

Cand. endo-1,3-β-glucanase

 

[38]

3917

3917a

123639

 

GH64

Cand. endo-1,3-β-glucanase

 

[38]

3917

3917a

124175

 

GH64

Cand. endo-1,3-β-glucanase

 

[38]

3917

3917b

25224

 

GH65

Cand. α,α-trehalase

 

[38]

2891

2891a

123456

 

GH65

Cand. α,α-trehalase

 

[38]

2891

2891a

72526

glr1

GH67

α-Glucuronidase

 

[29]

5113

5113a

71532

 

GH71

Cand. α-1,3-glucanase

 

[37]

287

287a

108672

 

GH71

Cand. α-1,3-glucanase

CBM24

[38]

287

287b

120873

 

GH71

Cand. α-1,3-glucanase

CBM24

[38]

287

287b

73179

 

GH71

Cand. α-1,3-glucanase

 

[37]

287

287c

22914

 

GH72

Cand. β-1,3-glucanosyltransferase

CBM43

[38]

111

111a

82633

 

GH72

Cand. β-1,3-glucanosyltransferase

 

[37]

111

111a

77942

 

GH72

Cand. β-1,3-glucanosyltransferase

 

[38]

111

111b

78713

 

GH72

Cand. β-1,3-glucanosyltransferase

 

[47]

111

111c

123538

 

GH72

Cand. β-1,3-glucanosyltransferase

 

[38]

111

111d

49081

cel74a

GH74

Xyloglucanase

CBM1

[16]

4769

4769a

42152

 

GH75

Cand. chitosanase

 

[38]

3832

3832a

70341

 

GH75

Cand. chitosanase

 

[38]

3832

3832a

66789

 

GH75

Cand. chitosanase

 

[38]

3832

3832b

49409

 

GH76

Cand. α-1,6-mannanase

 

[38]

129

129a

67844

 

GH76

Cand. α-1,6-mannanase

 

[38]

129

129a

69123

 

GH76

Cand. α-1,6-mannanase

 

[38]

129

129b

122495

 

GH76

Cand. α-1,6-mannanase

 

[38]

129

129b

53542

 

GH76

Cand. α-1,6-mannanase

 

[38]

129

129c

55802

 

GH76

Cand. α-1,6-mannanase

 

[38]

129

129c

74807

 

GH76

Cand. α-1,6-mannanase

 

[47]

3765

3765a

27395

 

GH76

Cand. α-1,6-mannanase

 

[38]

4345

4345a

58887

 

GH78

Cand. α-L-rhamnosidase

 

[38]

3807

3807a

71394

 

GH79

Cand. β-glucuronidase

 

[38], A

5190

5190a

73005

 

GH79

Cand. β-glucuronidase

 

[38], A

5190

5190a

106575

 

GH79

Cand. β-glucuronidase

 

[38], A

5190

5190a

72568

 

GH79

Cand. β-glucuronidase

 

[37], A

5190

5190b

73256

 

GH81

Cand. endo-1,3-β-glucanase

 

[38]

722

722

79602

 

GH81

Cand. endo-1,3-β-glucanase

 

[38]

722

722a

58117

 

GH89

Cand. α-N-acetylglucosaminidase

 

[38]

6562

6562a

69700

 

GH89

Cand. α-N-acetylglucosaminidase

 

[38]

6562

6562a

74198

 

GH92

Cand. α-1,2-mannosidase

 

[38]

318

318a

111733

 

GH92

Cand. α-1,2-mannosidase

 

[38]

318

318a

79921

 

GH92

Cand. α-1,2-mannosidase

 

[38]

318

318b

60635

 

GH92

Cand. α-1,2-mannosidase

 

[38]

318

318c

55733

 

GH92

Cand. α-1,2-mannosidase

 

[38]

318

318d

57098

 

GH92

Cand. α-1,2-mannosidase

 

[47]

318

318e

69493

 

GH92

Cand. α-1,2-mannosidase

 

[38]

318

318f

72488

 

GH95

Cand. α-L-fucosidase

 

[38]

2951

2951

5807

 

GH95

Cand. α-L-fucosidase

 

[38]

2951

2951a

111138

 

GH95

Cand. α-L-fucosidase

 

[37]

2951

2951a

58802

 

GH95

Cand. α-L-fucosidase

 

[38]

2951

2951b

4221

 

GH105

Cand. rhamnogalacturonyl hydrolase

 

This study

4036

4036a

57179

 

GH105

Cand. rhamnogalacturonyl hydrolase

 

[37]

4065

4065a

79606

 

GH115

Cand. xylan-α-1,2-glucuronidase or α-(4-O-methyl)-glucuronidase

 

This study

3202

3202a

103033

 

PL7

Cand. alginate lyase

 

[38]

9526

9526a

110259

 

PL7

Cand. alginate lyase

 

[38]

9526

9526a

111245

 

PL8

Cand. chondroitin lyase

 

[38]

10699

10699a

53186

TrGl

PL20

Glucuronan hydrolase

 

[91]

5536

5536a

69189

 

PL20

Cand. endo-β-1,4-glucuronan lyase

 

This study

5536

5536a

108348

 

GH

-

  

10159

 

105288

 

GH

-

  

29033

 

121136

 

GH

-

  

29033

 

Glycoside hydrolase, carbohydrate esterase (excluding CE10) and polysaccharide lyase genes of T. reesei, the annotation and functional diversification of the genes

(a), gene identifier as in T. reesei v2.0 data base [38]; (b), name given to the gene in the publication/data base marked in the reference column; (c), family and class of the enzyme according to the CAZy classification [5]; (d), cellulose binding module present in the protein; (e), reference to previous studies or to T. reesei database versions 1.2 and 2.0.; (f), protein cluster the T. reesei protein was assigned to when the protein clusters were mapped to CAZy database by a blast search; (g), functional subgroups within the protein cluster determined according to phylogenetic analysis. A, a previous annotation has been specified/updated during this study.

Annotation of T. reesei CAZyme genes

The annotations of the CAZyme genes of T. reesei were specified/updated (the information is summarized in the Additional file 3). The criteria used for the annotation were the relationship of CAZy database members and T. reesei CAZymes in the phylogenetic trees, the best blast hits in the CAZy database, predicted functional domains in the proteins ([55, 56], Additional file 4), together with the function predictions in the T. reesei v2.0 data base [37, 38]. The list of the 49 fungi in the protein homology clusters, with their abbreviations are shown in Additional file 5. For selected cases, alignment of the candidate CAZyme against the PFAM profile of the CAZy family was also used to confirm the CAZy family of the candidate gene. By these means, the T. reesei CAZyme genes, excluding glycosyltransferase and the family CE10 genes, were concluded to contain 201 GH (glycoside hydrolase) genes, 22 CE (carbohydrate esterase genes) and 5 PL (polysaccharide lyase) genes. The outcome of the annotation process and the functional diversification observed is summarised in Table 1. Phylogenetic trees showing the functional diversifications discussed in more detail, are shown in Additional file 6. In this study we focus on putative CAZymes involved in degradation of plant cell wall derived material, whereas proteins with other functions such as glycosylation or degradation of cell wall components were given less attention. Especially, the function predictions obtained for genes without previous annotation, or genes for which only a general prediction was available, are discussed.

Cellulase protein homology clusters

A good example to support the functional diversification predictions based on a phylogenetic analysis was the diversification of the well characterised GH7 genes, the cellobiohydrolase cbh1 and endoglucanase egl1. The encoded proteins are assigned to the same protein homology cluster but different functional subgroups in accordance with the known enzymatic activities of the proteins (Table 1A, Additional file 6). The third major component of the cellulolytic system, cellobiohydrolase CBHII belongs to the family GH6 and is the only member of the family in T. reesei. Endoglucanases can be found also in the glycoside hydrolase families GH5, GH12 and GH45. GH5 includes the characterised EGII, a candidate membrane-bound endoglucanase CEL5B in the same homology cluster and functional subgroup, and an additional endoglucanase candidate (53731) in a separate cluster (Table 1A). The other GH5 members include the β-mannanase MANI, and a candidate for a β-1,3-mannanase/endo-β-1,4-mannosidase (71554), glucan β-1,3-glucosidase (64375), endo-β-1,6-glucanase (64906) and a β-glycosidase (77506) without a specific functional prediction. GH12 family includes the characterised endoglucanase EGIII together with a candidate endoglucanase (77284) but in separate protein homology clusters (Table 1A). The endoglucanase EGV of the family GH45, as well as the xyloglucanase CEL74A of the family 74, are the only members of their families in T. reesei. GH61 family member EGIV/CEL61A has previously been described as an endoglucanase [13]. However, recently the family has been suggested to act in the degradation of lignocellulose material via an oxidative mechanism [18]. Based on our analysis, T. reesei genome harbours five candidate GH61 members in addition to EGIV/CEL61A. The encoded proteins are divided into three protein homology clusters and four functional subgroups inside the clusters (Table 1C).

In the case of β-glucosidases, experimental evidence supporting functional differences has only been obtained for BGLI and BGLII, the first being the major extracellular β-glucosidase and the second being an intracellular enzyme. However, phylogenetic analysis suggests that further functional differences may exist within this group of enzymes (Table 1A). Altogether, the T. reesei genome encodes eleven characterised or predicted β-glucosidases, two belonging to the family GH1 and nine to the family GH3. The intracellular GH1 β-glucosidases of T. reesei (BGLII and CEL1B, the latter predicted to be intracellular due to the lack of predicted signal sequence) are in the same protein homology cluster but in different functional subgroups. The β-glucosidases of family GH3 are divided into two homology clusters, and furthermore, showed diversification within the clusters, so that the genes could be assigned to nine groups. Functional diversification of the GH3 β-glucosidases within the same protein homology cluster is visualised in Figure 1 and Additional file 6. The predicted β-glucosidases 47268, 66832 and 104797 are assigned to the same cluster as BGLI, CEL3B and CEL3E, and 108671 to the same cluster as CEL3C and CEL3D. The GH3 β-glucosidases BGLI, CEL3E, CEL3B, 66832, 104797 and 108671 are predicted to be secreted according to the signal sequence prediction (SignalP 4.0, [57]).
Figure 1
Figure 1

Phylogeny of fungal β-glucosidases of family GH3. Phylograms containing the T. reesei proteins and homologous proteins of 48 other fungi in the database were constructed. (A), protein cluster 110; (B), protein cluster 132. Classification of the fungi is indicated with couloured symbols, T. reesei proteins marked with a diamond bordered with red. For a detailed presentation of the tree, including the abbreviations for the fungal strains and the Uniprot identifiers, see Additional file 6.

Hemicellulase and other CAZyme protein homology clusters

In addition to β-glucosidases, the family GH3 includes candidate β-N-acetylglucosaminidases (69557 and 79669) and β-xylosidases (BXLI and candidate 58450). The β-N-acetylglucosaminidases and β-xylosidases are found in separate protein homology clusters according to their (predicted) functions, and the β-xylosidases are also in separate functional subgroups (Table 1A). In addition to the GH3 β-xylosidases, T. reesei is predicted to encode a candidate β-xylosidase (73102) of the family GH39, and two proteins of the family GH43 predicted to have either β-xylosidase or α-L-arabinofuranosidase activity (68064, 3739), all in separate protein homology clusters (Table 1B). The characterised arabinofuranosidase ABFI and the candidate enzyme ABFIII of the family GH54 are not functionally diversed from each other according to the functional diversification criteria (Table 1C). In addition to these, the T. reesei genome also encodes a candidate arabinofuranosidase ABFII of the family GH62.

T. reesei has four characterized xylanases and two candidate xylanases. The characterized xylanases belong to families GH10 (XYNIII), GH11 (XYNI, XYNII) and GH30 (XYNIV). Candidate xylanases can be found from families GH11 (112392) and GH30 (69276). The candidate xylanase 112392 (also called XYNV in a recent publication, [58]) is assigned to the same protein homology cluster as XYNI and XYNII and is in the same functional subgroup as XYNI (Table 1A). Candidate xylanase 69276 is in the same homology cluster and functional subgroup as XYNIV (Table 1B).

The carbohydrate esterase families CE3 and CE5 contain known and/or candidate acetyl xylan esterases of T. reesei. The carbohydrate esterase family 5 includes both acetyl xylan esterases and cutinases (Table 1A). The candidate acetyl xylan esterases (54219 and AXEII) are in the same protein homology cluster with the characterized enzyme AXEI, the 54219 belonging to the same functional subgroup as AXEI. The candidate cutinase (60489) clusters together with known and candidate cutinase homologues of other fungi. Our study also revealed candidate members of CE3 family, including candidates for acetyl xylan esterases or esterase/suberinase. However, the ORF prediction (in the genome database [38]) for majority of the genes is unclear due to difficulties in prediction of N- or C-termini or intron positions, which hampers phylogenetic analysis of the genes.

Hemicellulases of T. reesei are also present in families GH2 and GH27. The family GH2 is one of the families including members with versatile enzymatic activities. The predicted members of GH2 of T. reesei include five candidate β-mannosidases (5836, 69245, 59689, 57857 and 62166) belonging to the same protein homology cluster but to three different functional subgroups within the cluster (Table 1A). GH2 members include also a candidate exo-β-D-glucosaminidase (77299), and a candidate enzyme with a predicted function as a β-galactosidase or β-glucuronidase (76852). The six candidate α-galactosidases (27219, 27259, 59391, 75015, 55999 and 65986) of family GH27 are divided to two protein homology clusters (Table 1B). Proteins encoded by genes 27219, 27259, 59391 and 75015 are assigned to the same cluster as AGLIII and are not functionally diversified either from AGLIII or from each other (cluster contained only T. reesei proteins). The remaining candidate α-galactosidases are in the same cluster as AGLI and are divided to two functional subgroups within the cluster.

Our study also suggested a new member of CE16 family and of PL20 family belonging to the same functional subgroup as the characterised AESI and TRGL, respectively (Table 1A and 1C). In addition to the known GH67 α-glucuronidase (GLRI), a GH115 type of α-glucuronidase (α-1,2- or α-(4-O-methyl)-glucuronidase) was predicted (79606). The T. reesei genome was also found to encode four candidate GH79 β-glucuronidases (71394, 106575, 72568, 73005) not identified previously, but which are probably involved in proteoglycan hydrolysis rather than lignocellulose degradation. Also an additional member of GH105 family, a predicted rhamnogalacturonyl hydrolase (4221), was identified in the study in addition to the previously predicted one (57179).

Comparison of T. reesei CAZyme homology clusters with other fungi

Comparison of T. reesei protein homology clusters with other fungi by looking at the number of genes per species in the clusters, revealed several interesting differences (Additional file 7). The cluster containing AGLIII and four candidate α-galactosidases is unique to T. reesei. This protein homology cluster is not found from any other of the 48 fungi included in this study. The cluster containing four candidate β-glucuronidases from family GH79 is expanded in T. reesei as compared to other fungi. T. reesei has 4 genes encoding these proteins while the other 48 fungi in this study contained only 0 to 3 genes. Similarly, the cluster containing candidate extracellular or membrane bound chitinases is expanded to include 6 genes in total, while in most of the 48 fungi there are 0 to 5 genes. This cluster corresponds to phylogenetic group B as described in a previous publication on chitinase phylogeny [59]. The cluster also contains chitinase CHI18-18 which was not included in group B. Expansion of GH18 genes of T. reesei has been described previously and it has been suggested to be involved in functions related to pathogenicity to other fungi [37].

The cluster containing seven genes from family GH92 is not found in Fusarium species that are the closest relatives of Trichoderma in our data set. It is possible that Fusarium genes have diversified further apart while Trichoderma genes have retained the ancestral functions. One of the two clusters that contain genes encoding members of family GH43 is hugely reduced in T. reesei compared to other Pezizomycotina species, especially Fusarium spp. T. reesei has only one gene in this cluster while Fusarium oxysporum has 12. Reduction is also visible in two protein homology clusters containing members from the family GH61. The reduction is especially notable in the cluster number 77 where T. reesei has only two genes while the number of genes in other Pezizomycotina can be as high as 43. These two reductions were already noticed during the initial genome analysis of T. reesei[37].

Horizontal gene transfer

Our study revealed also several cases of putative horizontal gene transfer from bacteria. As mentioned above, proteins encoded by genes 59791 and 73101 were assigned to protein homology clusters with no other fungal proteins i.e. they had no significant homologues in the fungal genomes included in the clustering. However, the proteins had homologues in the closely related Hypocrea (Trichoderma) species as well as a large number of bacterial homologues. 73101 had several bacterial GH16 family proteins as homologues, and a candidate endo-β-1,3-1,4-glucanase of Bacillus subtilis as the best blast hit in the CAZy database. 59791was closely related to GH18 family chitinases of Hypocrea (Trichoderma) species, and had homologues also especially in Streptomyces and Bacillus species. The phylogeny of the genes thus suggests possible gene transfer from bacteria. The possibility of horizontal gene transfer of 59791 has also been discussed in a previous publication [59]. In addition, a candidate β-glucosidase (108671) of GH3 was shown to be possibly a result of horizontal gene transfer. Although the protein is assigned to the same homology cluster as CEL3D and CEL3C beside proteins from other Trichoderma species, the closest homologous for this protein are from bacteria. The phylogenetic analysis of these genes are represented in additional files (59791 in Additional file 8, 73101 in Additional file 9, and 108671 in Additional file 10).

Identification of similarly expressed genes by visualization of the expression data

The induction of T. reesei CAZyme genes was studied by cultivating the fungus in the presence of different inducing substrates and analysing the transcriptional responses at different time points of induction using oligonucleotide microarrays. The transcript signals in induced cultures were compared to the ones in uninduced control cultures at the same time point. The microarray expression data on the CAZyme genes is represented in detail in the Additional file 11 (including the normalised log2 scale signal intensity of the genes in each condition, the fold change of the signal in the induced culture as compared to the uninduced control cultures at the same time point, and statistical significance of the difference in expression as compared to the control cultures at a corresponding time point). The substrates used in the study were differentially pretreated bagasse materials (ground bagasse without further pretreatment, bagasse pretreated by steam explosion, and bagasse hydrolysed enzymatically after steam explosion pretreatment), pretreated wheat straw and pretreated spruce, birch xylan, oat spelt xylan, Avicel cellulose and sophorose. Based on liquid chromatographic analysis of the carbohydrate content of the pretreated complex substrates (Table 2) and information obtained from the manufacturers of the other substrates used, bagasse and wheat straw are the most complex ones. Steam exploded wheat straw and pretreated bagasse material contain cellulose and arabinoxylan, but also polysaccharides with other substitutions, such as galactose or mannose units, whereas pretreated spruce consists mostly of cellulose. Sophorose is a disaccharide, 2-O-β-D-Glucopyranosyl-α-D-Glucose, that can be produced via transglycosylation reaction from cellobiose, a cleavage product of cellulose.
Table 2

Carbohydrate composition of the pre-treated biomass substrates

Sample

Rhamnose

Arabinose

Galactose

Glucose

Xylose

Mannose

Fructose

BS

< 0.1

0.54

0.15

59.5

12.59

0.24

< 0.1

BE

< 0.1

0.62

0.14

33

9.68

0.38

< 0.1

WH

< 0.1

0.38

< 0.1

61.6

2.96

0.12

-

SP

< 0.1

< 0.1

< 0.1

46

< 0.1

< 0.1

< 0.1

The amounts of the different carbohydrates are shown as mg/100 mg or dry matter. BS, steam exploded bagasse; BE, enzymatically hydrolysed bagasse; WH, wheat straw; SP, spruce.

The majority (179 genes) of the 228 CAZyme genes (excluding GT and CE10 family genes) were induced by at least one of the substrates used (higher expression level in the induced cultures as compared to the uninduced cultures at the same time point). The largest number of genes and CAZy families induced was detected in the cultures with the hemicellulosic material, bagasse, xylans and wheat straw (68–124 genes in 39–47 CAZy families), whereas cultivation in the presence of cellulosic or cellulose derived materials, Avicel cellulose, pretreated spruce, or sophorose, resulted in a clearly smaller number of genes induced (43–58 genes in 28–36 families). The number of induced genes within each CAZy family is represented in Figure 2.
Figure 2
Figure 2

CAZy family members induced in the presence of the different lignocellulose substrates. The number of genes in each CAZy family induced in the presence of the different lignocellulose substrates: BO, ground bagasse; BS, steam exploded bagasse; BE, enzymatically hydrolysed steam exploded bagasse; XO, oat spelt xylan; XB, birch xylan; AV1, 1% Avicel cellulose; AV0.75, 0.75% Avicel cellulose; WH, steam exploded wheat straw; SP, steam exploded spruce; SO, sophorose. The intensity of the colour represents the amount of genes induced. The total number of genes in each CAZy family induced by at least one of the substrates, and the total number of the CAZy family members in T. reesei genome are shown on the right. The total number of genes induced by the substrate and the number of CAZy families the genes belong to, are shown at the bottom. LC, lignocellulose substrate.

Based on the microarray data, the common core of genes induced in the presence of the lignocellulose substrates (as judged by induction of gene expression by both cellulose and xylan, and induction in the presence of at least 70% of the substrates used) included genes encoding characterised or predicted functions as GH6 cellobiohydrolase, GH5 endoglucanase, xylanases of families GH10, GH11 and GH30, GH5 β-mannanase, GH3 family β-glucosidases and β-xylosidases, GH27 α-galactosidases, GH2 β-mannosidases, acetyl xylan esterases of families CE3 and CE5, glucuronoyl and acetyl esterases of families CE15 and CE16, GH31 α-glucosidases/α-xylosidases, GH54 and GH43 α-L-arabinofuranosidases (or β-xylosidase/α-L-arabinofuranosidases), GH61 polysaccharide monooxygenases, GH55 β-1,3-glucanases, GH67 α-glucuronidase, GH79 β-glucuronidase, GH105 rhamnogalacturonyl hydrolase, GH95 α-L-fucosidase, GH89 α-N-acetylglucosaminidase, and chitinases of families GH18 and GH20.

The analysis revealed also a more refined pattern of co-expressed genes. To visualise the co-expressed gene groups as well as differences in the induction pattern of the genes in the presence of different substrates, a heatmap representation was used (Figure 3). The heatmap was generated using the fold changes of the transcript signals in the induced cultures vs. the uninduced cultures at the same time point for each of the genes.
Figure 3
Figure 3

Heat map representing expression profiles of T. reesei CAZyme genes when the fungus was grown on different lignocellulose substrates. The fold change of the expression signal in the induced culture vs. the signal in the uninduced cultures at the same time point for each gene is represented by the color code (see the color key for the log2 scale fold changes). The data for each gene is represented as rows (for gene IDs from top to bottom see the Additional file 11, column a), and the samples collected at different time points of induction (0 h, 6 h, or 17 h) in the presence of the different substrates are shown as columns. BO, ground bagasse; BS, steam exploded bagasse; BE, enzymatically hydrolysed steam exploded bagasse; XO, oat spelt xylan; XB, birch xylan; AV1, 1% Avicel cellulose; AV0.75, 0.75% Avicel cellulose; WH, steam exploded wheat straw; SP, steam exploded spruce; SO, sophorose. The heat map was divided to 18 sub-branches (A-R) according to similarities in expression profiles. The zero time points are indicated by a blue line at the bottom.

In the heatmap, the branches A, B, C and D represent genes that are induced by the presence of most of the substrates, and include many of the known cellulolytic and hemicellulolytic genes. Branch A contains genes that are rather evenly induced by all the substrates (egl4/cel61a, bxl1, xyn1, xyn4). The genes give strong signals in the inducing conditions, and have moderately high basal signal levels also in the uninduced conditions. The genes in branch B have an especially pronounced induction by the presence of Avicel cellulose and wheat, but reduced expression at the late time points of xylan cultures (candidate GH28 exo-polygalacturonase pgx1, candidate GH3 β-glucosidase cel3d, GH5 β-mannanase man1, candidate GH2 β-mannosidase, candidate GH61 polysaccharide monooxygenase cel61b). The genes in branch C are moderately induced by most of the substrates, but similarly to the branch B, many of the genes show reduction of the signal at the late time points of xylan cultures (candidate GH3 β-glucosidase bgl3f, candidate CE3 acetyl xylan esterase 41248, candidate GH18 chitinase chi18-7, CE16 acetyl esterase aes1, candidate GH105 rhamnogalacturonyl hydrolase 57179, candidate GH95 α-L-fucosidase 5807, GH27 α-galactosidase agl3, candidate GH55 β-1,3-glucanases 56418 and 54242). The branch D represents genes induced by most of the substrates but especially by the presence of xylans, steam exploded bagasse and wheat straw. In accordance with the strong induction by xylans, the branch D includes both known and candidate hemicellulase genes (GH67 α-glucuronidase glr1, GH11 endo-β-1,4-xylanase xyn2, candidate GH11 endo-β-1,4-xylanase xyn5, CE5 acetyl xylan esterase axe1 and a candidate CE5 acetyl xylan esterase).

Other distinctive groups of co-regulated genes are induced by subset of the substrates studied. The branch F is characterised by genes giving rather low or moderate signals in the array analysis and showing induction by birch xylan, steam exploded and enzymatically treated bagasse already at the early time points. This group includes e.g. candidates of GH16, GH18, GH27 and GH92 family genes among others. The genes in branch E show moderate expression and induction levels, mostly in the presence of wheat straw, but subgroups of the branch also with bagasse, spruce, oat spelt xylan or sophorose. The branch G represents genes induced especially by sophorose. This group contains many genes known to encode enzymes with activity on lignocellulose substrates, (GH3 β-glucosidase bgl1/cel3a, a candidate GH3 β-glucosidase cel3e, GH7 endo-β-1,4-glucanase egl1/cel7b, GH10 endo-β-1,4-xylanase xyn3, GH74 xyloglucanase cel74a, CE15 glucuronoyl esterase cip2) as well as candidates for GH30 endo-β-1,4-xylanase, and GH79 β-glucuronidase among others. Branch H contain genes that have moderately high signal levels and are induced in the presence of the cellulosic substrates, spruce, sophorose and Avicel, but whose signal levels are reduced in the presence of pretreated bagasse, wheat straw and birch xylan. This group contains especially candidate α-1,2-mannosidase genes of the family GH47, but also genes of families GH3 (β-glucosidase cel3c), GH5, GH16, GH17, GH27, GH55, GH76, and GH95. The branch I contains genes with the strongest induction at the late time point of xylan cultures (a candidate GH3 β-xylosidase xyl3b, a candidate GH3 β-glucosidase cel3b, GH36 α-galactosidase agl2, a candidate GH79 β-glucuronidase, a candidate PL7 polysaccharide lyase, chitinase genes of families GH18 and GH20 and a candidate GH31 α-glucosidase among others). The branch J contains genes with rather strong constitutive signals. Among others, the group contains both GH1 family β-glucosidase genes, a candidate GH3 family β-glucosidase gene, two GH5 family genes (cel5b and cel5d), a candidate CE5 acetyl xylan esterase axe2, a candidate CE3 family esterase, a candidate GH43 family β-xylosidase/arabinofuranosidase and a novel candidate GH115 family gene. For detailed gene content of the branches, see the Additional file 11.

The major cellobiohydrolase genes, cbh1 and cbh2, are erroneously included to branch J due to saturated signal level in the microarray analysis. The expression of these genes was studied separately using q-PCR (see below).

The microarray study also revealed a group of genes whose expression level was increased immediately after addition of the substrate, but induction (as compared to the control cultures) ceased soon after that. These genes can be found especially in heatmap branches I, L, M, O, and R (Figure 3). These included e.g. genes encoding two candidate β-mannosidases (5836 and 69245), candidate β-xylosidase (58450), a chitinase (chi18-3), two α-L-arabinofuranosidases (abf1 and abf3), two candidate α-1,2-mannosidases (74198 and 60635), a candidate endo-polygalacturonase (103049), endoglucanase (egl3), a candidate GH2 family protein (102909), two α-galactosidases (agl1 and agl2) and a glycoside hydrolase for which a family could not be assigned (105288). From these genes chi18-3, egl3, abf3 and genes 74198, 5836, 69245, 102909, 105288 and 60635 were induced at the early time point by at least five of the substrates. It is notable that several genes induced at early time point encode enzymes that are involved in hemicellulose degradation (mannose backbone degradation, releasing side chains from hemicellulose and digesting oligosaccharides derived from hemicellulose).

Due to the importance of β-glucosidases in the total hydrolysis of lignocellulose biomass and the observation that members of GH3 are abundantly induced by different substrates and are functionally very diverse according to the phylogenetic analysis, the induction of GH3 β-glucosidase genes was inspected in more detail (Figure 4). The expression patterns of the GH3 β-glucosidase genes differed clearly from one another. A set of the genes was induced most strongly in the presence of sophorose and Avicel cellulose, but not that much on the xylans, whereas some of the genes showed equal or higher induction in the presence of bagasse and xylans as in the presence of the cellulosic materials, and some lacked induction by the substrates. In addition, the induction pattern of the GH3 β-glucosidase genes showed gene specific features. Gene cel3d showed strong induction by all the substrates except for the xylans. The strongest induction was obtained in the presence of Avicel, wheat, spruce and sophorose. Genes bgl1/cel3a and cel3e were strongly induced on sophorose, but also showed a milder induction by many other substrates, especially in the presence of Avicel. Gene cel3c was induced by sophorose and Avicel, but also by spruce and ground bagasse. Genes cel3b and 108671 were moderately induced by the majority of the substrates except for cel3b on wheat and sophorose and 108671 on oat spelt xylan and spruce. Gene 104797 was mildly induced by all the substrates, most by oat spelt xylan and sophorose. Genes 47268 and 66832 were hardly at all induced by the substrates studied.
Figure 4
Figure 4

Expression profiles of T. reesei GH3 β-glucosidase genes. The maximal induction level in each of the culture conditions is shown as the fold change of the signal in the induced cultures vs. the signal in the uninduced cultures at the time point when the induction was the highest (log2 scale). The blue and red colours represent negative and positive changes in the expression, respectively. The intensity of the colour is proportional to the magnitude of induction/repression. BO, ground bagasse; BS, steam exploded bagasse; BE, enzymatically hydrolysed steam exploded bagasse; XO, oat spelt xylan; XB, birch xylan; AV1, 1% Avicel cellulose; AV0.75, 0.75% Avicel cellulose; WH, steam exploded wheat straw; SP, steam exploded spruce; SO, sophorose.

47 CAZyme genes did not show up-regulation in the presence of any of the substrates as compared to the control cultures (Additional file 11). Most of the uninduced genes are predicted to encode functions other than lignocellulose degradation. Especially, the uninduced genes included genes encoding proteins likely to be involved in processing of cell wall components, chitin processing/degradation, utilisation of storage carbon or 1,4-α-glucan substrates, or protein glycosylation. Expression information could not be obtained for four genes that are absent from the Rut-C30 genome due to a large deletion in scaffold 15 (the genes 25224, 64906, 65215 and 122780) [60, 61].

Identification of expression of highly induced genes and confirmation of microarray results by quantitative PCR

The major cellulase genes, cbh1 and cbh2, are among the most abundantly expressed genes in T. reesei (within the top 0.5% of the genes in the dataset). In the microarray analysis, the induction of the genes was barely detectable due to saturation of the signal levels. It was also suspected that the magnitude of induction of the major endoglucanase genes, egl1 and egl2, might be too low in the microarray analysis. In order to study the expression of these genes, a quantitative PCR analysis of samples collected at the 17 hour time point of induction was carried out. According to the qPCR analysis, cbh1 and cbh2 were induced in the presence of all other substrates except for cbh2 on birch xylan, and cbh1 on neither of the xylans (Figure 5). Endoglucanase gene egl1 was induced in the presence of ground and steam exploded bagasse, Avicel, spruce and sophorose and egl2 was induced especially in the presence of steam exploded bagasse, but also in the presence of Avicel, wheat, spruce, sophorose and oat spelt xylan. Furthermore, the array data on the earlier time points of induction showed induction of egl2 also on ground and enzymatically pretreated bagasse as well as on birch xylan.
Figure 5
Figure 5

Quantitative PCR analysis of highly expressed genes. Samples collected at 17 h time point of induction were subjected to the qPCR analysis. The expression levels normalised with gpd1 signal are shown in the graphs as a fold change as compared to the uninduced control cultures at the same time point. The values are means of two biological replicates, and the error bars indicate standard deviation. (A) Expression of cbh1, cellobiohydrolase 1; (B) expression of cbh2, cellobiohydrolase 2; (C) expression of egl1, endoglucanase 1; (D) expression of egl2, endoglucanase 2.

In addition, a set of genes covering both abundantly and moderately expressed genes were included in the qPCR analysis in order to validate the microarray method and to investigate the detection limits of the two methods. The additional set of genes in the qPCR analysis included abf1, axe1, bxl1, cel3c, cel3d, cel61b, swo1, xyn1, xyn2, xyn3 and xyn4. A scatter plot comparing the log2 signal intensities of the microarray data to the Cp values of qPCR data is represented in the Additional file 12. The log2 signal intensities of the microarray data correlate reasonably well with qPCR data at microarray signal level below 15, above which the microarray signal start to become saturated.

Discussion

Although T. reesei is an important producer of enzymes for industry and biorefinery applications, little is known about the expression of the enzyme genes in the presence of complex biomass substrates. In this study, the expression of the CAZyme genes of T. reesei was studied using several substrates as inducers of gene expression. Substrates included complex biomass materials that are of interest from a biorefinery point of view, as well as purified polysaccharides and a simple inducing disaccharide. In addition, the annotations and functional predictions of T. reesei CAZymes were updated using computational and manual methods, including phylogenetic information. This was done in order to assist deeper understanding of T. reesei plant biomass degrading enzymes, their regulation and identification of essential enzymatic activities and enzyme genes for complete biomass degradation. After the initial annotation of the T. reesei genome [37], attempts to identify all T. reesei cellulolytic and hemicellulolytic genes has been done using genome version 1.2 [62] but to our knowledge this is the first publication after the initial annotation in which the T. reesei genome v2.0 has been searched for the CAZyme genes and the phylogenetic data has been thoroughly explored to assist the annotation process.

A BLAST based method together with phylogenetic information was used to identify 201 glycoside hydrolase genes, 22 carbohydrate esterase genes (CE10 genes were left out) and 5 polysaccharide lyase genes in total. Detected discrepancies between the annotations of the genome versions 1.2 [47] and 2.0 [38] and published literature were corrected, and additional refined functional predictions were made for a set of CAZymes based on the analyses. In total 13 putatively new T. reesei CAZyme genes were identified during this study (Table 1). Several of these genes belonged to the carbohydrate esterase class which indicates that this group of T. reesei enzymes is still less studied than the glycoside hydrolases. Two additional candidate GH61 genes were found emphasizing the possible importance of GH61 enzymes as accessory enzymes in cellulose degradation, although the number of GH61 genes of T. reesei is still reduced as compared to other fungi ([37], Additional file 7). For 31 T. reesei CAZyme genes the annotation was either refined or a new annotation was given (Table 1). Updated annotations were abundant especially in families GH16, GH17 and GH79. Updated annotations revealed, among others, a fifth candidate GH2 β-mannosidase, a putative ninth GH3 β-glucosidase, a putative second GH12 endoglucanase and the first candidate GH39 β-xylosidase.

In the annotation process, protein homology clusters from 49 fungal species (including T. reesei) were mapped to the CAZy database for CAZy family assignment and functional prediction of the genes/gene products, and phylograms of the homology clusters were constructed to assist the annotation of T. reesei CAZymes. The phylogenetic relationship of the genes/proteins within the clusters was used to predict further functional diversification of the genes.

Several known and candidate lignocellulose degrading enzymes of T. reesei displayed functional diversification within the protein homology clusters, even in the cases in which the enzymes belonged to the same CAZy family and for whom similar activity was predicted based on the closest homologues. Particularly T. reesei β-glucosidases of family GH3 and α-galactosidases of GH27 were functionally diverse (Table 1, Figure 1, Additional file 6). It is also worth noting, that GH18 chitinases were extremely diverse by dividing in to as many as five different protein homogy clusters and into 12–13 functional subgroups (Table 1, Additional file 6). A group of chitinases was induced by the lignocellulose substrates used in the study. It is possible that some of the genes encode functions other than merely chitin degradation, since most of the T. reesei chitinases are not biochemically characterized. It could also be hypothesized that the saprophytic way of life and pathogenicity towards other fungi would share common regulation mechanisms.

In most cases where the phylogenetic analysis suggested functional diversification, the expression of the genes on different substrates differed as well, as judged based on clustering of the expression profiles (Table 1, Figure 3). A good example of this is the family GH3 β-glucosidases, which were all divided in separate functional subgroups, and whose expression patterns differed from each other. Tight co-regulation was relatively rare among the genes that belonged to the same functional subgroup, also indicating diverted regulation of these genes. However, in a few cases genes of the same functional subgroup were co-regulated. An example of such a case is the GH2 candidate β-mannosidases (5836 and 69245), belonging to the same functional subgroup and showing co-induction immediately after addition of the substrates. The observation that functional diversification is rather common for the CAZymes of T. reesei and that the diversification can be seen in differential expression, suggests that the diversified enzymes might be involved in substrate specific processes and/or have different biochemical properties.

The expression analysis of the CAZyme genes in the presence of different substrates revealed distinct groups of co-expressed genes (Figure 3). Part of the CAZyme genes were induced in the presence of both xylan and cellulose type of substrates. The group of genes showing the most consistent induction in the presence of all the substrates used in the experiment contained many genes related to xylanolytic activities. The majority of the CAZyme genes showed differential expression patterns on different types of substrates. Some of the genes exhibited induction especially on the xylan containing material, either on the pure xylans or the complex material containing xylan. The induction of some of the genes was dependent on the type of xylan used in the experiment, suggesting that side chains on xylan may play a role in the induction process. The different types of side chains may contribute also to induction of the genes by different biomass material. The induction of the genes in the xylan cultures also showed temporal differences, some of the genes were induced at the late time points of the induction experiment and some were specific to early stages in xylan cultures or cultures with the xylan containing complex material. A group of genes was induced especially on the cellulosic material, either Avicel or pretreated spruce, and on other complex material to different extent. Part of the cellulose induced genes was induced also in the presence of sophorose. Sophorose can be generated as a transglycosylation product from cellulose degradation product, cellobiose, and therefore could act as a primary inducer in cellulose cultures. Interestingly, a set of genes were induced prímarily by sophorose and only to a lesser extent by the more complex materials. Furthermore, a number of examples were detected where the genes showed stronger induction in the presence of the complex material as compared to the purified polymers, or where the genes were only induced in the presence of the complex material.

Our data also showed a group of CAZyme genes that were induced at the early time points immediately after addition of the inducing substrates, after which their expression declined. Induction only at early time points followed by a decline at later time points could indicate that the enzyme is either required to initialise hydrolysis of the substrate or to be involved in recognizing the polymer substrate and cutting inducing monomers from the substrate.

The results suggest that several regulatory mechanisms, depending on the inducers present, may act on the CAZyme gene promoters simultaneously, and in some cases also in an additive manner. The complex material may also provide other inducing components than the xylan and cellulose derived inducers. Complete hydrolysis of complex biomass derived material most likely requires action of the enzymes as a cascade. At the initial stages certain components are exposed to act as inducers or as sources for inducer formation and certain linkages are accessible for the enzymatic cleavage. As the degradation proceeds, additional components and linkages are exposed requiring other enzymatic activities for cleavage and, different induction mechanisms to produce the enzymes. The regulation of genes encoding xylanolytic enzymes of the model organism Neurospora crassa has been suggested to involve several regulatory groups. Xylanase regulator XLR-1 was suggested to work alone or in combination with other unknown regulators and a XLR-1 independent group of genes was also suggested to exist [63]. The results of our study support the theory of several different regulatory groups which may be partly overlapping.

Comparison of transcriptional profiling data sets reveals the partly different regulatory mechanisms employd by different fungi. The most notable differences between the Avicel regulons of T. reesei and N. crassa are the larger number of T. reesei GH3 genes induced as compared to N. crassa and the larger amount of N. crassa CE1 and GH61 genes induced as compared to T. reesei. There are also differences between the xylan induced genes of the two fungi which are partly due to the fact that in contrast to T. reesei, N. crassa cellulase genes are not induced by xylan [63]. N. crassa cellulase genes are also not induced by sophorose [64].

Conclusions

Computational and manual approaches, also including phylogenetic analysis, was used to update and refine annotation of the CAZyme gene content of T. reesei and to study the functional diversification of T. reesei CAZyme genes. As an outcome of this study several putatively new CAZyme genes of T. reesei were detected, discrepancies between the annotations of the different genome versions and published literature were corrected, and additional refined functional predictions were made for a set of CAZymes. In addition, phylogenetic analysis revealed functional diversification within the CAZy families and enzyme activity groups.

The analysis of T. reesei CAZyme gene expression in the presence of different licgnocellulose materials showed a complex pattern of co-regulated groups of genes. Both substrate dependent and temporal differences in the induction of the different groups of genes were detected. The results suggest that several regulatory mechanisms, depending on the inducers present, may act on the CAZyme gene promoters simultaneously, and in some cases the different mechanisms may also act in an additive manner. The complex regulatory system may be required to accomplish complete hydrolysis of biomass derived material by the enzymes produced. Different sets of enzymes are likely to be required to hydrolyse different materials at the different stages of the hydrolysis, thus setting a demand for complex regulatory mechanisms to ensure energetically cost-effective enzyme production in the cells.

Identification of the CAZyme content of T. reesei genome together with the expression analysis in the presence of different lignocellulose materials has given evidence for the importance of several yet uncharacterized enzymes in the degradation of biomass substrates and also new information on the enzymes needed for the complete degradation of different lignocellulose substrates. Furthermore, the information on the co-regulated groups of genes can be utilised in further studies to elucidate the regulatory mechanisms of the genes.

Methods

Strains, media and culture conditions

The strain used for the transcriptional profiling was Trichoderma reesei Rut-C30 (ATCC 56765, VTT-D-86271, [65]) obtained from VTT Culture Collection. For preparation of spore suspension, the fungus was grown on potato-dextrose plates (Difco) for 5 days. The spores were dislodged, suspended in a buffer containing 0.8% NaCl, 0.025% Tween20 and 20% glycerol, filtered through cotton, and stored at −80°C.

For the induction experiments, T. reesei was first cultivated on minimal medium ((NH4)2SO4 7.6 g l-1, KH2PO4 15.0 g l-1, 2.4 mM MgSO4.7H2O, 4.1 mM CaCl2.H2O, CoCl2 3.7 mg l-1, FeSO4.7H2O 5 mg l-1, ZnSO4.7H2O 1.4 mg l-1, MnSO4.7H2O 1.6 mg l-1, pH adjusted to 4.8 with KOH) supplemented with 2% (w/v) of sorbitol as a carbon source. The medium was inoculated with 8 × 107 spores per 200 ml aliquots of the medium, and cultivated in shake flasks at 28°C, with shaking at 250 rpm, until biomass dry weight in the cultures was close to 0.9 g/l (4 days). In order to get equal starting material for all the inducing conditions, the preculture aliquots were first mixed together, then divided again in 200 ml aliquots in shake flasks, and let to recover for 30 min at 28°C with shaking at 250 rpm before addition of the inducing substrates. The inducing substrates (for details, see below), suspended in 100 ml of minimal medium, were combined with the 200 ml aliquots of the preculture to start the induction, and the cultivation was continued under the same conditions (28°C, 250 rpm) for 3 days. In uninduced control cultures, 100 ml of minimal medium without inducer was added, and the control cultures were treated similarly to the induced cultures throughout the experiment. Samples for RNA isolation were collected after 0 min, 6 hours, 17 hours, 41 hours and 65 hours of the onset of the induction. The time points were selected to be long enough for induction but to minimize the possible changes in the gene expression related to the growth of the fungus. For the RNA isolation, the mycelium was collected by filtering, washed with equal volume of 0.7% NaCl, frozen immediately in liquid nitrogen, and stored at −80°C. In addition samples for determining the biomass dry weight were withdrawn from the precultures and separate uninduced control cultures during the induction. Biomass dry weight was determined by drying the mycelium samples, collected as above, to constant weight. pH of the cultures was measured throughout the cultivation.

In this study, the induction experiment was carried out in two parts. In the first cultivation set, the inducing substrates used were 0.75% (w/v) Avicel cellulose (Fluka BioChemika), 1% (dry matter w/v) pretreated wheat straw, 1% (dry matter w/v) pretreated spruce, or 0.75 mM α-sophorose (Serva). In the second cultivation set the inducing substrates were 1% (w/v) Avicel cellulose (Fluka BioChemika), 1% (w/v) bagasse ground to homogenous composition, 1% (dry matter w/v) bagasse pretreated using steam explosion, 1% (dry matter w/v) enzymatically hydrolysed pretreated bagasse, 1% (w/v) birch xylan (Roth 7500), 1% (w/v) oat spelt xylan (Sigma-Aldrich, XO627). Uninduced control cultures were included in both cultivation sets. The inducing substrates were added at the same phase of active growth in both cultivation sets. In the first set the biomass dry weight was 0.81 g/l by the addition of the inducers, and 0.97 g/l in the second set, being less than 25% of the maximal biomass in the experiment. Biomass dry weight measurement showed that growth continued logarithmically in the control cultures of both sets during the mock induction. The same specific growth rate, 0.024/h, was measured for both cultivation sets (Figure 6). Thus, it was concluded that the induction took place at a similar growth phase in both cultivation sets. Fungal biomass dry weight could not be measured in the induced cultures due to the insoluble substrates added.
Figure 6
Figure 6

Growth curves of the control cultures in the induction experiments. Biomass dry weight at different time points of cultivation is shown in a linear scale (A), and in a logarithmic scale (B) for calculation of the specific growth rate. Equations for the linear trend lines of the growth curve after the induction time point, 100 h, are shown in the legend of panel B.

Preparation of the inducing substrates

Steam exploded spruce was kindly provided by Guido Zacchi (Lund University, Sweden). Steam explosion had been done as in [66]. Steam exploded wheat straw was obtained from IFP Energies Nouvelles (France). Bagasse was pretreated by steam explosion using steam pressure 14.5 bar at 200°C (10 l kettle) for 5 minutes without the addition of acid or SO2 (kindly provided by Anne Kallioinen, VTT). The steam exploded material was washed with distilled water (1 kg/200 ml) after which the insoluble material was filtered, washed with hot tap water (1 kg/2000 ml) and filtered again to obtain an insoluble fibre fraction. The filtered spruce and bagasse materials were washed further twice with 2 l of 82°C distilled water (filtered between washes) and once with 400 ml of 85°C distilled water after which the material was filtered.

Enzymatically pretreated bagasse was obtained by incubating the washed fibre fraction of the steam exploded bagasse with the cellulase mixture Celluclast 1.5 L FG (Novozymes) (50 FPU/g cellulose in the material) and β-glucosidase Novozym 188 DCN00206 (Novozymes) (500 nkat /g cellulose in the material) in 50 mM sodium acetate buffer, pH 4.8, first for 24 h at 45°C with shaking 160 rpm. After the initial 24 h of incubation, insoluble material was collected by centrifugation (20 min, 5300 g, 20°C, Sorvall RC12BP H12000 rotor), resuspended in fresh buffer, and incubation was continued with newly added enzymes (as above) for further 48 h. After the incubation, insoluble material was recovered by centrifugation as above and washed three times with distilled water (pH adjusted to 2.5 with HCl). After the cellulase treatment, the material was resuspensed in final concentration of 5% (w/v) in 50 mM Na2HPO4, pH 6.0, and incubated with Protease N (PRW12511N, Amano) (100 nkat / substrate dry weight) for 24 h at 40°C with magnetic stirring. Insoluble fraction was collected by centrifugation, resuspended in 80°C distilled water, and incubated at 80°C for 15 min to inactivate the protease. The insoluble material was washed three times with 1 volume of distilled water.

The carbohydrate composition of the pre-treated substrates (mg/100 mg of dry matter) is shown in Table 2.

Isolation of total RNA, preparation of cDNA, and microarray analytics

Frozen mycelium was ground under liquid nitrogen using mortar and pestle, and total RNA was isolated using Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to manufacturer's instructions. RNA was purified using RNeasy Mini Kit (Qiagen, Hilden, Germany) and RNA concentration was measured using NanoDrop ND-1000 (NanoDrop Technologies Inc. Wilmington, DE, USA). Integrity of RNA was analysed using Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).

Microarray analysis of total RNA isolated from the first cultivation set (with Avicel, wheat straw, spruce and sophorose as inducing substrates) was carried out by Roche NimbleGen (Roche‐NimbleGen, Inc., Madison, WI, USA) as part of their array service, including the synthesis and labelling of cDNA, hybridization of cDNA on microarray slides, and scanning of the slides to produce the raw data files. For the microarray analysis of the second cultivation set, the total RNA samples were processed essentially according to the instructions by RocheNimblegen. The double-stranded cDNA was synthesised using Superscript Double-Stranded cDNA synthesis Kit (Invitrogen), and the integrity of the double-stranded cDNA was analyzed using Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). The double-stranded cDNA was labelled with Cy3 fluorescent dye, hybridized to microarray slides (Roche‐NimbleGen, Inc., Madison, WI, USA) and scanned using Roche NimbleGen Microarray scanner according to the instructions of the manufacturer.

The probe design and manufacturing of the microarray slides was carried out by RocheNimbleGen. For the first cultivation set the design was based on the T. reesei genome version 1.2 [47] as described in [67]. For the second cultivation set, an array design based on the T. reesei genome version 2.0 [38] was used. In the latter array format, six 60mer probes were designed for each of the genes.

The microarray data was analysed using the R package Oligo for preprocessing of the data and the package Limma for identifying differentially expressed genes [6870]. In the analysis of the differentially expressed genes, the signals in the samples of the induced cultures were compared to the ones of uninduced control cultures at the corresponding time point. Four biological replicates were analysed for each condition and each time point. The cut-off used for statistical significance was p-value < 0.01, and an additional cut-off for the log2-scale fold change (>0.4) was set.

Quantitative PCR

Total RNA isolated from samples collected at the induction time point 17 h were subjected to qPCR analysis of a selected set of genes. cDNA was synthesized using Transcriptor High Fidelity cDNA synthesis kit (Roche), 2 μg of total RNA as a template. A dilution of 1:100 from the cDNA sample was used for assays. qPCR reaction was performed using LightCycler 480 SYBR Green I Master kit (Roche) and Light Cycler 480 II instrument according to the instructions of the manufacturer. The primers used in the qPCR are listed in Table 3. The results were analysed with LightCycler 480 Software release 1.5.0. (version 1.5.0.39) using gpd1 signal for normalisation. The results are shown as a fold change as compared to the uninduced control cultures.
Table 3

Primers used in the quantitative PCR method

Gene

5' forward primer

3' reverse primer

cbh1

GCGGATCCTCTTTCTCAG

ATGTTGGCGTAGTAATCATCC

cbh2

TCCTGGTTATTGAGCCTGAC

GCAACATTTGGAAGGTTCAG

egl1

GTCTACTACGAACTCGAC

GTAGTAGTCGTTGCTATACTG

egl2

CTGTACCACAGATGGCAC

ATCATACTTGGAAATGCTCG

xyn1

AAACTACCAAACTGGCGG

TTGATGGGAGCAGAAGATCC

xyn2

CGGCTACTTCTACTCGTACTG

TTGATGACCTTGTTCTTGGTG

xyn4

TTTGACATTGCGACATGGC

GCCGCTATAATCCCAGGT

abf1

ATATCCTTCCGATGCAACAG

AGAGATTGACGAACCGAC

axe1

TAAAGCAGCAATCTTCATGG

GCAGTAAGACTTGATCTTGG

cel3c

ACATCAAGCATTTCATCGCC

ACACTATCCATAAAGGGCCA

cel3d

AGCATATCTCAACTACGCCA

GAAGGTAGCGTAAGACAGG

bxl1

GTCACTCTTCCAAGCTCAG

ATCGTTACCTCTTCTCCCA

cel61b

TGAACTTCTTGCTGCCCA

TAGAGCTGAGTTGCAGGAG

xyn3

TACAAGGGCAAGATTCGTG

ACTGGCTTCCAATACCGT

gpd1

TCCATTCGTGTCCCTACC

AGATACCAGCCTCAATGTC

swo1

ATTACTACACCCAATTCTGGTC

GACAGCCGTATTTGAAGTC

Mapping T. reesei proteome to CAZy database

Information in the CAZy database [5, 6] was downloaded family by family (November 2010). The sequence information of reported CAZy family members was then downloaded from NCBI [71] using the database identifier listed on CAZy site. For sequences that did not have a NCBI idenfier, a Uniprot identifier was used instead. Sequences that did not have either identifier were left out. Finally, a searchable BLAST database was created from the protein sequence information using formatdb command from the BLAST program suite [48]. The information on the CAZy family annotation was retained during the construction of the local CAZy BLAST database. The local CAZy BLAST database was queried with each T. reesei protein using blastp [48]. Only blast matches having E-value smaller than 10-11 were retained.

Each T. reesei gene with significant similarity to CAZy database genes was mapped to protein homology clusters described in [49] and updated to include 49 fungi [50], and all the protein members of the found clusters were mapped to CAZy by blastp [48]. A cluster member protein was identified as a CAZyme (carbohydrate active enzyme) if it had a hit in CAZy dabase of at least 97% identity covering over 200 amino acids in the blastp alignment (Additional file 2).

Interpro protein domains [55] from all protein sequences were predicted using InterproScan [72].

Phylogenetic analysis of T. reesei CAZymes

Reconstruction of phylograms of protein homology clusters was carried out as in [73] i.e. the sequences of the proteins in the clusters were aligned with MAFFT [74, 75], the alignments trimmed with trimAL [76] and phylogenetic trees constructed with RAxML version 7.2.8 [77], except that due to the large number of trees only 100 bootstraps per tree were made. Trees were visualised using the R [78] library ape [79].

Aligning T. reesei CAZymes against the PFAM profiles of a CAZy family

Sequences belonging to selected CAZy families were clustered to help annotate T. reesei proteins belonging to the family. The members of the CAZy family, including T. reesei candidates, were aligned to the PFAM [80] profile of the family using hmmalign from the HMMer program package [81]. The alignment was then fed into the same pipeline that was used for the construction of phylograms of protein homology clusters. Namely, the alignment was trimmed with trimAL [76] and phylogenetic trees constructed with RAxML version 7.2.8 [77], except that due to the large number of trees only 100 bootstraps per tree were made. Typically the sequences grouped in the phylogenetic tree by order (fungal, bacterial) and by function. Annotation of T. reesei proteins was conducted by studying the members of the CAZy family assigned to the same branch as the T. reesei protein and by studying whether the T. reesei protein contained the conserved amino acids typical for the members of the CAZy family.

Abbreviations

CAZy: 

Carbohydrate active enzyme database

CAZyme: 

Carbohydrate active enzyme

CBM: 

Cellulose binding module

CE: 

Carbohydrate esterase

GH: 

Glycoside hydrolase

GT: 

Glycosyl transferase

PL: 

Polysaccharide lyase.

Declarations

Acknowledgements

Aili Grundström is acknowledged for extremely skillful technical assistance. The work was co-funded by the European Commission within the Sixth Framework Programme (2002–2006) (NILE, New Improvements for Lignocellulosic Ethanol, Contract No 019882), Tekes – the Finnish Funding Agency for Technology and Innovation (SugarTech, Hydrolysis technology to produce biomass-based sugars for chemical industry raw materials, Tekes 1503/31/2008), and Academy of Finland (The regulatory network of the cellulolytic and hemicellulolytic system of Trichoderma reesei, Decision no 133455). Work of MA was funded by Academy of Finland Postdoctoral Researcher's fellowship 127715.

Authors’ Affiliations

(1)
VTT Technical Research Centre of Finland, VTT, Espoo, Finland

References

  1. Sánchez C: Lignocellulosic residues: Biodegradation and bioconversion by fungi. Biotechnol Adv. 2009, 27 (2): 185-194. 10.1016/j.biotechadv.2008.11.001.View ArticleGoogle Scholar
  2. McKendry P: Energy production from biomass (part 1): overview of biomass. Bioresour Technol. 2002, 83 (1): 37-46. 10.1016/S0960-8524(01)00118-3.View ArticleGoogle Scholar
  3. Jordan DB, Bowman MJ, Braker JD, Dien BS, Hector RE, Lee CC, Mertens JA, Wagschal K: Plant cell walls to ethanol. Biochem J. 2012, 442 (2): 241-252. 10.1042/BJ20111922.View ArticleGoogle Scholar
  4. Sukumaran RK, Singhania RR, Mathew GM, Pandey A: Cellulase production using biomass feed stock and its application in lignocellulose saccharification for bio-ethanol production. Renew Energy. 2009, 34 (2): 421-424. 10.1016/j.renene.2008.05.008.View ArticleGoogle Scholar
  5. Carbohydrate active enzymes database. http://www.cazy.org/.
  6. Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B: The Carbohydrate-active enxymes database (CAZy): an expert resource for glycogenomics. Nucleic Acids Res. 2009, 37 (suppl 1): D233-D238.View ArticleGoogle Scholar
  7. Schuster A, Schmoll M: Biology and biotechnology of Trichoderma. Appl Microbiol Biotechnol. 2010, 87 (3): 787-799. 10.1007/s00253-010-2632-1.View ArticleGoogle Scholar
  8. Teeri T, Salovuori I, Knowles J: The molecular cloning of the major cellulase gene from Trichoderma reesei. Nat Biotech. 1983, 1 (8): 696-699. 10.1038/nbt1083-696.View ArticleGoogle Scholar
  9. Shoemaker S, Schweickart V, Ladner M, Gelfand D, Kwok S, Myambo K, Innis M: Molecular cloning of exo-cellobiohydrolase I derived from Trichoderma reesei strain L27. Nat Biotech. 1983, 1 (8): 691-696. 10.1038/nbt1083-691.View ArticleGoogle Scholar
  10. Teeri TT, Lehtovaara P, Kauppinen S, Salovuori I, Knowles J: Homologous domains in Trichoderma reesei cellulolytic enzymes: Gene sequence and expression of cellobiohydrolase II. Gene. 1987, 51 (1): 43-52. 10.1016/0378-1119(87)90472-0.View ArticleGoogle Scholar
  11. Penttilä M, Lehtovaara P, Nevalainen H, Bhikhabhai R, Knowles J: Homology between cellulase genes of Trichoderma reesei: complete nucleotide sequence of the endoglucanase I gene. Gene. 1986, 45 (3): 253-263. 10.1016/0378-1119(86)90023-5.View ArticleGoogle Scholar
  12. Okada H, Tada K, Sekiya T, Yokoyama K, Takahashi A, Tohda H, Kumagai H, Morikawa Y: Molecular characterization and heterologous expression of the gene encoding a low-molecular-mass endoglucanase from Trichoderma reesei QM9414. Appl Environ Microbiol. 1998, 64 (2): 555-563.Google Scholar
  13. Saloheimo M, Nakari-Setälä T, Tenkanen M, Penttilä M: cDNA cloning of a Trichoderma reesei cellulase and demonstration of endoglucanase activity by expression in yeast. Eur J Biochem. 1997, 249 (2): 584-591. 10.1111/j.1432-1033.1997.00584.x.View ArticleGoogle Scholar
  14. Saloheimo A, Henrissat B, Hoffrén A, Teleman O, Penttilä M: A novel, small endoglucanase gene, egl5, from Trichoderma reesei isolated by expression in yeast. Mol Microbiol. 1994, 13 (2): 219-228. 10.1111/j.1365-2958.1994.tb00417.x.View ArticleGoogle Scholar
  15. Saloheimo M, Lehtovaara P, Penttilä M, Teeri TT, Ståhlberg J, Johansson G, Pettersson G, Claeyssens M, Tomme P, Knowles JKC: EGIII, a new endoglucanase from Trichoderma reesei: the characterization of both gene and enzyme. Gene. 1988, 63 (1): 11-21. 10.1016/0378-1119(88)90541-0.View ArticleGoogle Scholar
  16. Foreman PK, Brown D, Dankmeyer L, Dean R, Diener S, Dunn-Coleman NS, Goedegebuur F, Houfek TD, England GJ, Kelley AS, Meerman HJ, Mitchell T, Mitchinson C, Olivares HA, Teunissen PJM, Yao J, Ward M: Transcriptional regulation of biomass-degrading enzymes in the filamentous fungus Trichoderma reesei. J Biol Chem. 2003, 278 (34): 31988-31997. 10.1074/jbc.M304750200.View ArticleGoogle Scholar
  17. Grishutin SG, Gusakov AV, Markov AV, Ustinov BB, Semenova MV, Sinitsyn AP: Specific xyloglucanases as a new class of polysaccharide-degrading enzymes. Biochimica et Biophysica Acta (BBA) - General Subjects. 2004, 1674 (3): 268-281. 10.1016/j.bbagen.2004.07.001.View ArticleGoogle Scholar
  18. Langston JA, Shaghasi T, Abbate E, Xu F, Vlasenko E, Sweeney MD: Oxidoreductive cellulose depolymerization by the enzymes cellobiose dehydrogenase and glycoside hydrolase 61. Appl Environ Microbiol. 2011, 77 (19): 7007-7015. 10.1128/AEM.05815-11.View ArticleGoogle Scholar
  19. Fowler T, Brown RD: The bgI1 gene encoding extracellular β-glucosidase from Trichoderma reesei is required for rapid induction of the cellulase complex. Mol Microbiol. 1992, 6 (21): 3225-3235. 10.1111/j.1365-2958.1992.tb01777.x.View ArticleGoogle Scholar
  20. Saloheimo M, Kuja-Panula J, Ylosmaki E, Ward M, Penttila M: Enzymatic properties and intracellular localization of the novel Trichoderma reesei β-glucosidase BGLII (Cel1A). Appl Environ Microbiol. 2002, 68 (9): 4546-4553. 10.1128/AEM.68.9.4546-4553.2002.View ArticleGoogle Scholar
  21. Takashima S, Nakamura A, Hidaka M, Masaki H, Uozumi T: Molecular cloning and expression of the novel fungal β-glucosidase genes from Humicola grisea and Trichoderma reesei. J Biochem. 1999, 125 (4): 728-736. 10.1093/oxfordjournals.jbchem.a022343.View ArticleGoogle Scholar
  22. Barnett CC, Berka RM, Fowler T: Cloning and amplification of the gene encoding an extracellular β-glucosidase from Trichoderma reesei: evidence for improved rates of saccharification of cellulosic substrates. Nat Biotech. 1991, 9 (6): 562-567. 10.1038/nbt0691-562.View ArticleGoogle Scholar
  23. Saloheimo M, Paloheimo M, Hakola S, Pere J, Swanson B, Nyyssönen E, Bhatia A, Ward M, Penttilä M: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials. Eur J Biochem. 2002, 269 (17): 4202-4211. 10.1046/j.1432-1033.2002.03095.x.View ArticleGoogle Scholar
  24. Tenkanen M, Puls J, Poutanen K: Two major xylanases of Trichoderma reesei. Enzyme Microb Technol. 1992, 14 (7): 566-574. 10.1016/0141-0229(92)90128-B.View ArticleGoogle Scholar
  25. Torronen A, Mach RL, Messner R, Gonzalez R, Kalkkinen N, Harkki A, Kubicek CP: The two major xylanases from Trichoderma reesei: characterization of both enzymes and genes. Nat Biotech. 1992, 10 (11): 1461-1465. 10.1038/nbt1192-1461.View ArticleGoogle Scholar
  26. Xu J, Takakuwa N, Nogawa M, Okada H, Okada H: A third xylanase from Trichoderma reesei PC-3-7. Appl Microbiol Biotechnol. 1998, 49 (6): 718-724. 10.1007/s002530051237.View ArticleGoogle Scholar
  27. Stalbrand H, Saloheimo A, Vehmaanpera J, Henrissat B, Penttila M: Cloning and expression in Saccharomyces cerevisiae of a Trichoderma reesei beta-mannanase gene containing a cellulose binding domain. Appl Environ Microbiol. 1995, 61 (3): 1090-1097.Google Scholar
  28. Margolles-Clark E, Tenkanen M, Soderlund H, Penttila M: Acetyl xylan esterase from Trichoderma reesei contains an active-site serine residue and a cellulose-binding domain. Eur J Biochem. 1996, 237 (3): 553-560. 10.1111/j.1432-1033.1996.0553p.x.View ArticleGoogle Scholar
  29. Margolles-Clark E, Saloheimo M, Siika-aho M, Penttilä M: The α-glucuronidase-encoding gene of Trichoderma reesei. Gene. 1996, 172 (1): 171-172. 10.1016/0378-1119(96)00167-9.View ArticleGoogle Scholar
  30. Margolles-Clark E, Tenkanen M, Nakari-Setala T, Penttila M: Cloning of genes encoding alpha-L-arabinofuranosidase and beta-xylosidase from Trichoderma reesei by expression in Saccharomyces cerevisiae. Appl Environ Microbiol. 1996, 62 (10): 3840-3846.Google Scholar
  31. Herpoël-Gimbert I, Margeot A, Dolla A, Jan G, Mollé D, Lignon S, Mathis H, Sigoillot J, Monot F, Asther M: Comparative secretome analyses of two Trichoderma reesei RUT-C30 and CL847 hypersecretory strains. Biotechnol Biofuels. 2008, 1: 18-10.1186/1754-6834-1-18.View ArticleGoogle Scholar
  32. Margolles-Clark E, Tenkanen M, Luonteri E, Penttilä M: Three α-galactosidase genes of Trichoderma reesei cloned by expression in yeast. Eur J Biochem. 1996, 240 (1): 104-111. 10.1111/j.1432-1033.1996.0104h.x.View ArticleGoogle Scholar
  33. Zeilinger S, Kristufek D, Arisan-Atac I, Hodits R, Kubicek CP: Conditions of formation, purification, and characterization of an alpha-galactosidase of Trichoderma reesei RUT C-30. Appl Environ Microbiol. 1993, 59 (5): 1347-1353.Google Scholar
  34. Li X, Skory CD, Cotta MA, Puchart V, Biely P: Novel family of carbohydrate esterases, based on identification of the Hypocrea jecorina acetyl esterase gene. Appl Environ Microbiol. 2008, 74 (24): 7482-7489. 10.1128/AEM.00807-08.View ArticleGoogle Scholar
  35. Pokkuluri PR, Duke NEC, Wood SJ, Cotta MA, Li X, Biely P, Schiffer M: Structure of the catalytic domain of glucuronoyl esterase Cip2 from Hypocrea jecorina. Proteins: Structure, Function, and Bioinformatics. 2011, 79 (8): 2588-2592. 10.1002/prot.23088.View ArticleGoogle Scholar
  36. Li X, Špániková S, de Vries RP, Biely P: Identification of genes encoding microbial glucuronoyl esterases. FEBS Lett. 2007, 581 (21): 4029-4035. 10.1016/j.febslet.2007.07.041.View ArticleGoogle Scholar
  37. Martinez D, Berka RM, Henrissat B, Saloheimo M, Arvas M, Baker SE, Chapman J, Chertkov O, Coutinho PM, Cullen D, Danchin EGJ, Grigoriev IV, Harris P, Jackson M, Kubicek CP, Han CS, Ho I, Larrondo LF, de Leon AL, Magnuson JK, Merino S, Misra M, Nelson B, Putnam N, Robbertse B, Salamov AA, Schmoll M, Terry A, Thayer N, Westerholm-Parvinen A, Schoch CL, Yao J, Barabote R, Nelson MA, Detter C, Bruce D, Kuske CR, Xie G, Richardson P, Rokhsar DS, Lucas SM, Rubin EM, Dunn-Coleman N, Ward M, Brettin TS: Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina). Nat Biotech. 2008, 26 (5): 553-560. 10.1038/nbt1403.View ArticleGoogle Scholar
  38. Trichoderma reesei genome database v2.0. http://genome.jgi-psf.org/Trire2/Trire2.home.html.
  39. Aro N, Pakula T, Penttilä M: Transcriptional regulation of plant cell wall degradation by filamentous fungi. FEMS Microbiol Rev. 2005, 29 (4): 719-739. 10.1016/j.femsre.2004.11.006.View ArticleGoogle Scholar
  40. Schmoll M, Kubicek CP: Regulation of Trichoderma cellulase formation: lessons in molecular biology from an industrial fungus. Acta Microbiol Immunol Hung. 2003, 50 (2): 125-145. 10.1556/AMicr.50.2003.2-3.3.View ArticleGoogle Scholar
  41. Kubicek C, Mikus M, Schuster A, Schmoll M, Seiboth B: Metabolic engineering strategies for the improvement of cellulase production by Hypocrea jecorina. Biotechnol Biofuels. 2009, 2 (1): 19-10.1186/1754-6834-2-19.View ArticleGoogle Scholar
  42. Margolles-clark E, Ilmen M, Penttilä M: Expression patterns of ten hemicellulase genes of the filamentous fungus Trichoderma reesei on various carbon sources. J Biotechnol. 1997, 57 (1–3): 167-179.View ArticleGoogle Scholar
  43. Verbeke J, Coutinho P, Mathis H, Quenot A, Record E, Asther M, Heiss-Blanquet S: Transcriptional profiling of cellulase and expansin-related genes in a hypercellulolytic Trichoderma reesei. Biotechnol Lett. 2009, 31 (9): 1399-1405. 10.1007/s10529-009-0030-5.View ArticleGoogle Scholar
  44. Ilmen M, Saloheimo A, Onnela M, Penttila M: Regulation of cellulase gene expression in the filamentous fungus Trichoderma reesei. Appl Environ Microbiol. 1997, 63 (4): 1298-1306.Google Scholar
  45. Nogawa M, Goto M, Okada H, Morikawa Y: l -Sorbose induces cellulase gene transcription in the cellulolytic fungus Trichoderma reesei. Curr Genet. 2001, 38 (6): 329-334. 10.1007/s002940000165.View ArticleGoogle Scholar
  46. Mach-Aigner AR, Gudynaite-Savitch L, Mach RL: L-Arabitol is the actual inducer of xylanase expression in Hypocrea jecorina (Trichoderma reesei). Appl Environ Microbiol. 2011, 77 (17): 5988-5994. 10.1128/AEM.05427-11.View ArticleGoogle Scholar
  47. Trichoderma reesei genome database v1.2. http://genome.jgi-psf.org/trire1/trire1.home.html.
  48. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997, 25 (17): 3389-3402. 10.1093/nar/25.17.3389.View ArticleGoogle Scholar
  49. Arvas M, Kivioja T, Mitchell A, Saloheimo M, Ussery D, Penttila M, Oliver S: Comparison of protein coding gene contents of the fungal phyla Pezizomycotina and Saccharomycotina. BMC Genomics. 2007, 8 (1): 325-10.1186/1471-2164-8-325.View ArticleGoogle Scholar
  50. Gasparetti C, Faccio G, Arvas M, Buchert J, Saloheimo M, Kruus K: Discovery of a new tyrosinase-like enzyme family lacking a C-terminally processed domain: production and characterization of an Aspergillus oryzae catechol oxidase. Appl Microbiol Biotechnol. 2010, 86 (1): 213-226. 10.1007/s00253-009-2258-3.View ArticleGoogle Scholar
  51. Wolfe KH, Shields DC: Molecular evidence for an ancient duplication of the entire yeast genome. Nature. 1997, 387 (6634): 708-713. 10.1038/42711.View ArticleGoogle Scholar
  52. Kellis M, Birren BW, Lander ES: Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature. 2004, 428 (6983): 617-624. 10.1038/nature02424.View ArticleGoogle Scholar
  53. Costenoble R, Picotti P, Reiter L, Stallmach R, Heinemann M, Sauer U, Aebersold R: Comprehensive quantitative analysis of central carbon and amino-acid metabolism in Saccharomyces cerevisiae under multiple conditions by targeted proteomics. Mol Syst Biol. 2011, 7: 464-View ArticleGoogle Scholar
  54. Taylor JW, Berbee ML: Dating divergences in the fungal tree of life: review and new analyses. Mycologia November/December. 2006, 98 (6): 838-849. 10.3852/mycologia.98.6.838.View ArticleGoogle Scholar
  55. Hunter S, Jones P, Mitchell A, Apweiler R, Attwood TK, Bateman A, Bernard T, Binns D, Bork P, Burge S, de Castro E, Coggill P, Corbett M, Das U, Daugherty L, Duquenne L, Finn RD, Fraser M, Gough J, Haft D, Hulo N, Kahn D, Kelly E, Letunic I, Lonsdale D, Lopez R, Madera M, Maslen J, McAnulla C, McDowall J, McMenamin C, Mi H, Mutowo-Muellenet P, Mulder N, Natale D, Orengo C, Pesseat S, Punta M, Quinn AF, Rivoire C, Sangrador-Vegas A, Selengut JD, Sigrist CJA, Scheremetjew M, Tate J, Thimmajanarthanan M, Thomas PD, Wu CH, Yeats C, Yong S: InterPro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. 2012, 40 (D1): D306-D312. 10.1093/nar/gkr948.View ArticleGoogle Scholar
  56. NCBI conserved domains database. http://www.ncbi.nlm.nih.gov/cdd.
  57. Petersen TN, Brunak S, von Heijne G, Nielsen H: SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Meth. 2011, 8 (10): 785-786. 10.1038/nmeth.1701.View ArticleGoogle Scholar
  58. Metz B, Seidl-Seiboth V, Haarmann T, Kopchinskiy A, Lorenz P, Seiboth B, Kubicek CP: Expression of biomass-degrading enzymes is a major event during conidium development in Trichoderma reesei. Eukaryot Cell. 2011, 10 (11): 1527-1535. 10.1128/EC.05014-11.View ArticleGoogle Scholar
  59. Seidl V, Huemer B, Seiboth B, Kubicek CP: A complete survey of Trichoderma chitinases reveals three distinct subgroups of family 18 chitinases. FEBS J. 2005, 272 (22): 5923-5939. 10.1111/j.1742-4658.2005.04994.x.View ArticleGoogle Scholar
  60. Le Crom S, Schackwitz W, Pennacchio L, Magnuson JK, Culley DE, Collett JR, Martin J, Druzhinina IS, Mathis H, Monot F, Seiboth B, Cherry B, Rey M, Berka R, Kubicek CP, Baker SE, Margeot A: Tracking the roots of cellulase hyperproduction by the fungus Trichoderma reesei using massively parallel DNA sequencing. Proc Natl Acad Sci. 2009, 106 (38): 16151-16156. 10.1073/pnas.0905848106.View ArticleGoogle Scholar
  61. Seidl V, Gamauf C, Druzhinina I, Seiboth B, Hartl L, Kubicek C: The Hypocrea jecorina (Trichoderma reesei) hypercellulolytic mutant RUT C30 lacks a 85 kb (29 gene-encoding) region of the wild-type genome. BMC Genomics. 2008, 9 (1): 327-10.1186/1471-2164-9-327.View ArticleGoogle Scholar
  62. Ouyang J, Yan M, Kong D, Xu L: A complete protein pattern of cellulase and hemicellulase genes in the filamentous fungus Trichoderma reesei. Biotechnol J. 2006, 1 (11): 1266-1274. 10.1002/biot.200600103.View ArticleGoogle Scholar
  63. Sun J, Tian C, Diamond S, Glass NL: Deciphering transcriptional regulatory mechanisms associated with hemicellulose degradation in Neurospora crassa. Eukaryot Cell. 2012, 11 (4): 482-493. 10.1128/EC.05327-11.View ArticleGoogle Scholar
  64. Znameroski EA, Coradetti ST, Roche CM, Tsai JC, Iavarone AT, Cate JHD, Glass NL: Induction of lignocellulose-degrading enzymes in Neurospora crassa by cellodextrins. Proc Natl Acad Sci. 2012, 109 (16): 6012-6017. 10.1073/pnas.1118440109.View ArticleGoogle Scholar
  65. Montenecourt BS, Eveleigh DE: Preparation of mutants of Trichoderma reesei with enhanced cellulase production. Appl Environ Microbiol. 1977, 34 (6): 777-782.Google Scholar
  66. Stenberg K, Tengborg C, Galbe M, Zacchi G: Optimisation of steam pretreatment of SO2-impregnated mixed softwoods for ethanol production. J Chem Technol Biotechnol. 1998, 71 (4): 299-308. 10.1002/(SICI)1097-4660(199804)71:4<299::AID-JCTB858>3.0.CO;2-Z.View ArticleGoogle Scholar
  67. Arvas M, Pakula T, Smit B, Rautio J, Koivistoinen H, Jouhten P, Lindfors E, Wiebe M, Penttila M, Saloheimo M: Correlation of gene expression and protein production rate - a system wide study. BMC Genomics. 2011, 12: 616-10.1186/1471-2164-12-616.View ArticleGoogle Scholar
  68. Bolstad BM, Irizarry RA, Åstrand M, Speed TP: A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics. 2003, 19 (2): 185-193. 10.1093/bioinformatics/19.2.185.View ArticleGoogle Scholar
  69. Bioconductor, open source software for bioinformatics. http://www.bioconductor.org/.
  70. Smyth GK, Michaud J, Scott HS: Use of within-array replicate spots for assessing differential expression in microarray experiments. Bioinformatics. 2005, 21 (9): 2067-2075. 10.1093/bioinformatics/bti270.View ArticleGoogle Scholar
  71. National center for biotechnology information. http://www.ncbi.nlm.nih.gov/.
  72. Quevillon E, Silventoinen V, Pillai S, Harte N, Mulder N, Apweiler R, Lopez R: InterProScan: protein domains identifier. Nucleic Acids Res. 2005, 33 (suppl 2): W116-W120.View ArticleGoogle Scholar
  73. Koivistoinen OM, Arvas M, Headman JR, Andberg M, Penttilä M, Jeffries TW, Richard P: Characterisation of the gene cluster for l-rhamnose catabolism in the yeast Scheffersomyces (Pichia) stipitis. Gene. 2012, 492 (1): 177-185. 10.1016/j.gene.2011.10.031.View ArticleGoogle Scholar
  74. Katoh K, Misawa K, Kuma K, Miyata T: MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30 (14): 3059-3066. 10.1093/nar/gkf436.View ArticleGoogle Scholar
  75. Katoh K, Kuma K, Toh H, Miyata T: MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 2005, 33 (2): 511-518. 10.1093/nar/gki198.View ArticleGoogle Scholar
  76. Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T: trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009, 25 (15): 1972-1973. 10.1093/bioinformatics/btp348.View ArticleGoogle Scholar
  77. Stamatakis A: RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006, 22 (21): 2688-2690. 10.1093/bioinformatics/btl446.View ArticleGoogle Scholar
  78. Team RDC: R: A Language and Environment for Statistical Computing. 2008, Vienna, Austria: R Foundation for Statistical ComputingGoogle Scholar
  79. Paradis E, Claude J, Strimmer K: APE: Analyses of phylogenetics and evolution in R language. Bioinformatics. 2004, 20 (2): 289-290. 10.1093/bioinformatics/btg412.View ArticleGoogle Scholar
  80. Punta M, Coggill PC, Eberhardt RY, Mistry J, Tate J, Boursnell C, Pang N, Forslund K, Ceric G, Clements J, Heger A, Holm L, Sonnhammer ELL, Eddy SR, Bateman A, Finn RD: The Pfam protein families database. Nucleic Acids Res. 2012, 40 (D1): D290-D301. 10.1093/nar/gkr1065.View ArticleGoogle Scholar
  81. Finn RD, Clements J, Eddy SR: HMMER web server: interactive sequence similarity searching. Nucleic Acids Res. 2011, 39 (suppl 2): W29-W37.View ArticleGoogle Scholar
  82. BLAST: Basic local alignment search tool. http://blast.ncbi.nlm.nih.gov/Blast.cgi.
  83. Ike M, Isami K, Tanabe Y, Nogawa M, Ogasawara W, Okada H, Morikawa Y: Cloning and heterologous expression of the exo-β-d-glucosaminidase-encoding gene (gls93) from a filamentous fungus, Trichoderma reesei PC-3-7. Appl Microbiol Biotechnol. 2006, 72 (4): 687-695. 10.1007/s00253-006-0320-y.View ArticleGoogle Scholar
  84. Dunn-Coleman N, Neefe-Kruithof P, Pilgrim CE, Van Solingen P, Ward DE: Trichoderma reesei glucoamylase and homologs thereof. United States Patent. 2009, 11/510: 892-(7494685).Google Scholar
  85. Ike M, Nagamatsu K, Shioya A, Nogawa M, Ogasawara W, Okada H, Morikawa Y: Purification, characterization, and gene cloning of 46 kDa chitinase (Chi46) from Trichoderma reesei PC-3-7 and its expression in Escherichia coli. Appl Microbiol Biotechnol. 2006, 71 (3): 294-303. 10.1007/s00253-005-0171-y.View ArticleGoogle Scholar
  86. Stals I, Samyn B, Sergeant K, White T, Hoorelbeke K, Coorevits A, Devreese B, Claeyssens M, Piens K: Identification of a gene coding for a deglycosylating enzyme in Hypocrea jecorina. FEMS Microbiol Lett. 2010, 303 (1): 9-17. 10.1111/j.1574-6968.2009.01849.x.View ArticleGoogle Scholar
  87. Saloheimo M, Siika-Aho M, Tenkanen M, Penttila M: Xylanase from Trichoderma reesei, method for production thereof, and methods employing this enzyme. Patent. 2003, 09/658: 772-6555335.Google Scholar
  88. Geysens S, Pakula T, Uusitalo J, Dewerte I, Penttilä M, Contreras R: Cloning and characterization of the glucosidase II alpha subunit gene of Trichoderma reesei: a frameshift mutation results in the aberrant glycosylation profile of the hypercellulolytic strain Rut-C30. Appl Environ Microbiol. 2005, 71 (6): 2910-2924. 10.1128/AEM.71.6.2910-2924.2005.View ArticleGoogle Scholar
  89. Seiboth B, Hartl L, Salovuori N, Lanthaler K, Robson GD, Vehmaanpera J, Penttila ME, Kubicek CP: Role of the bga1-encoded extracellular β-galactosidase of Hypocrea jecorina in cellulase induction by lactose. Appl Environ Microbiol. 2005, 71 (2): 851-857. 10.1128/AEM.71.2.851-857.2005.View ArticleGoogle Scholar
  90. Maras M, Callewaert N, Piens K, Claeyssens M, Martinet W, Dewaele S, Contreras H, Dewerte I, Penttilä M, Contreras R: Molecular cloning and enzymatic characterization of a Trichoderma reesei 1,2-α-d-mannosidase. J Biotechnol. 2000, 77 (2–3): 255-263.View ArticleGoogle Scholar
  91. Konno N, Igarashi K, Habu N, Samejima M, Isogai A: Cloning of the Trichoderma reesei cDNA encoding a glucuronan lyase belonging to a novel polysaccharide lyase family. Appl Environ Microbiol. 2009, 75 (1): 101-107. 10.1128/AEM.01749-08.View ArticleGoogle Scholar

Copyright

© Häkkinen et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement