Skip to main content
Download PDF

Conversion of methionine biosynthesis in Escherichia coli from trans- to direct-sulfurylation enhances extracellular methionine levels

Microbial Cell Factories volume 22, Article number: 151 (2023) Cite this article

Abstract

Methionine is an essential amino acid in mammals and a precursor for vital metabolites required for the survival of all organisms. Consequently, its inclusion is required in diverse applications, such as food, feed, and pharmaceuticals. Although amino acids and other metabolites are commonly produced through microbial fermentation, high-yield biosynthesis of L-methionine remains a significant challenge due to the strict cellular regulation of the biosynthesis pathway. As a result, methionine is produced primarily synthetically, resulting in a racemic mixture of D,L-methionine. This study explores methionine bio-production in E. coli by replacing its native trans-sulfurylation pathway with the more common direct-sulfurylation pathway used by other bacteria. To this end, we generated a methionine auxotroph E. coli strain (MG1655) by simultaneously deleting metA and metB genes and complementing them with metX and metY from different bacteria. Complementation of the genetically modified E. coli with metX/metY from Cyclobacterium marinum or Deinococcus geothermalis, together with the deletion of the global repressor metJ and overexpression of the transporter yjeH, resulted in a substantial increase of up to 126 and 160-fold methionine relative to the wild-type strain, respectively, and accumulation of up to 700 mg/L using minimal MOPS medium and 2 ml culture. Our findings provide a method to study methionine biosynthesis and a chassis for enhancing L-methionine production by fermentation.

Introduction

Methionine is a sulfur-containing amino acid that plants, fungi and bacteria synthesize, but not vertebrates; thus, it is considered an essential amino acid. Although it is one of the less abundant amino acids in proteins [1], its hydrophobic nature contributes significantly to the stabilization of proteins’ structure [2, 3]. Methionine also plays an essential role in initiating mRNA translation and indirectly regulates various cellular processes by serving as the precursor of S-adenosyl-methionine (SAM), a biological methyl group donor [4, 5]. As an essential amino acid for vertebrates, addition of L-methionine for food, feed or other biotechnological applications is often necessary since balanced amounts of methionine must be consumed [6, 7]. However, microbial production of methionine beyond physiological levels is challenging due to its high cellular energy demands and the strict cellular regulation of its synthesis and accumulation [8,9,10]. The primary method to produce methionine for food and feed supplementation involves chemical synthesis, resulting in a racemic mixture of D,L-methionine and additional toxic compounds that must be removed from the final product. Thus, there is increasing demand to produce the natural form of L-methionine through an efficient bio-fermentation process [11, 12].

Enhancement of methionine production in E. coli

Efforts to produce methionine in bacteria have mainly focused on the clearance of negative regulation, controlling the metabolic flux in and out of the pathway and removing feedback inhibition of enzymes that comprise part of the biosynthesis pathway [9, 13,14,15,16]. For instance, disruption of metJ, which is a master regulator of the methionine pathway, together with overexpression of the genes encoding for MetA and the methionine-exporter YjeH (Fig. 1), resulted in an approximately ten-fold improvement in the production of L-methionine in E. coli [17, 18]. Additionally, enhancing the synthesis of upstream precursors required for methionine biosynthesis, alongside the simultaneous alteration of multiple pathways, was shown to be important for an optimized methionine bioproduction [8, 19, 20]. Moreover, modifications of regulatory elements, controlling the expression of multiple related genes, and supplementation of the bacterial growth medium with specific metabolites that were identified as limiting factors all resulted in a substantial increase of methionine levels of up to 18 g/L [9, 21,22,23].

Bacterial direct- and trans-sulfurylation pathways for biosynthesis of methionine

Trans- and direct-sulfurylation are the two main pathways for sulfur assimilation in bacterial methionine biosynthesis. As the names imply, the two pathways differ in the sulfur assimilation steps [24,25,26,27,28]. In trans-sulfurylation, homoserine is converted to L-homocysteine in three steps that are catalyzed by the enzymes MetA, MetB, and MetC, which are also known as L-homoserine O-succinyl transferase (HST; EC 2.3.1.46), cystathionine gamma synthase (CgS; EC 2.5.1.48), and cystathionine beta lyase (CbL; EC 4.4.1.13), respectively (Fig. 1). MetA synthesizes O-succinyl or O-acetyl L-homoserine, and MetB uses cysteine and O-succinyl L-homoserine to form cystathionine. In this pathway, inorganic sulfur in the form of hydrogen sulfide is first incorporated into cysteine by the enzyme O-acetylserine sulfhydrylase A (CysK), such that cysteine serves as the sulfur donor for the following synthesis of methionine [29]. MetC converts cystathionine into L-homocysteine (Fig. 1).

In the direct-sulfurylation pathway, L-homoserine is converted into L-homocysteine in only two steps, catalyzed by the enzymes MetX and MetY, known as L-homoserine O-acetyltransferases (HAT; EC 2.3.1.31) and O-acetylhomoserine sulfhydrylase (OAHS; EC 2.5.1.49), respectively. MetX produces O-acetyl L-homoserine from homoserine and acetyl-CoA, while MetY combines O-acetyl L-homoserine with an inorganic sulfur in the form of hydrogen sulfide to form L-homocysteine; thus, the latter does not rely on cysteine as the sulfur source (Fig. 1). Similar to sulfur assimilation during cysteine biosynthesis, E. coli can reduce sulfate to sulfide and process sulfur from various other sources such as sulfite, sulfide, or thiosulfate [30].

Fig. 1
figure 1

Direct- and trans-sulfurylation of methionine biosynthesis in bacteria. The first step in methionine biosynthesis involves the activation of homoserine through an acylation step. Two enzymes encoded by metAs and metXa genes [31] activate homoserine. The enzyme homoserine succinyl transferase (HST, MetAs) converts homoserine and succinyl-CoA into O-succinyl-L-homoserine (OSH). The enzyme homoserine acetyl transferase (HAT, MetXa) converts homoserine and acetyl-CoA into O-acetyl-L-homoserine (OAH). In the trans-sulfurylation pathway, cysteine and O-succinyl-L-homoserine (OSH) are converted into cystathionine by cystathionine-γ-synthase (CgS, MetB). Cystathionine is converted into homocysteine by cystathionine-β-lyase CbL (MetC). In the direct-sulfurylation pathway, OAH is converted into homocysteine by O-acetylhomoserine sulfhydrylase (OAHS, MetY). Metabolites in the pathways are boxed. MetJ and McbR are master negative regulators in E. coli and C. glutamicum, respectively. Additional abbreviations: MetF − 5,10-methylenetetrahydrofolate reductase, MetK - S-adenosylmethionine synthase, MetE - Cobalamin-independent methionine synthase, MetH - Methionine synthase, YjeH - L-methionine exporter, SAM - S-adenosyl-methionine

Full size image

Exploring alternative pathways for sulfur assimilation in E. coli

While most bacteria use the direct-sulfurylation pathway for methionine biosynthesis, E. coli utilizes the trans-sulfurylation pathway [24, 28, 32]. This pathway is less parsimonious in terms of the number of steps and proteins involved and depends on sulfur to be first assimilated into cysteine [24, 33, 34]. To control the methionine biosynthesis pathway in E. coli, key enzymes in the trans-sulfurylation pathway are strictly regulated and feedback-inhibited by methionine and SAM [24, 35]. Thus, while E. coli is a valuable workhorse in synthetic biology, the trans-sulfuration pathway might be a limiting step for using it to bio-produce methionine. An alternative approach to bypass the inherent regulation of E. coli on methionine biosynthesis involves introducing genes from various organisms that are less prone to inhibition. Indeed, it was shown that MetX from Leptospira meyeri is not feedback-inhibited by methionine or SAM [36]. Previous studies have demonstrated that the introduction of genes involved in the direct-sulfurylation pathway can significantly enhance methionine production in E. coli [37]. Moreover, it has been observed that genes sourced from bacteria utilizing direct-sulfurylation can serve to complement for methionine auxotrophy in E. coli [38, 39].

Therefore, the primary objective of this study was to investigate the impact on methionine biosynthesis of concurrently deleting both metA and metB genes and replacing them with metX and metY. This genetic modification would facilitate a complete transition of E. coli from trans- to direct-sulfurylation, thereby affecting methionine levels. Our findings demonstrate that the deletion of the metA/B genes in E. coli MG1655 resulted in a methionine auxotroph that could be complemented by the insertion of metX/Y genes from various sources. Furthermore, we found that the origin of the genes and their catalytic activity were closely associated with the ability of E. coli to produce methionine, leading to a significant increase in intra- and extra-cellular methionine levels.

Results

Engineering of methionine auxotroph E. coli

To explore the option of converting the E. coli methionine biosynthesis pathway from trans- to direct-sulfurylation, we deleted two essential genes in the methionine pathway of E. coli, metA and metB, encoding for the enzymes HST and CGS, respectively (Fig. 1). This deletion generated a methionine auxotroph E. coli strain (ΔmetAB). Figure 2 shows growth curves of ΔmetAB in a MOPS minimal medium containing glucose and ammonium chloride as the carbon and nitrogen sources, respectively, and K2SO4 as the main sulfur source. To test the effect of methionine on the growth rate, we supplemented varying concentrations of external methionine, as indicated in Fig. 2. While the WT bacteria grew normally without supplementation of methionine, the ΔmetAB methionine auxotroph was unable to grow. However, ΔmetAB growth was rescued with the addition of methionine. At a concentration of 25 μg/ml methionine, ΔmetAB growth reached maximal levels and the cell density resembled that of the WT bacteria, demonstrating that methionine was indeed the limiting growth factor.

Fig. 2
figure 2

E. coliΔmetAB is auxotrophic for methionine. WT and ΔmetAB were grown in a minimal MOPS medium with or without supplementation of external methionine for 900 min at 37 °C. The legend shows supplemented methionine concentration in μg/ml

Full size image

Complementation of E. coli ΔmetAB by metX and metY genes from different bacterial genomes

With the aim of exploring E. coli’s ability to synthesize methionine via the direct-sulfurylation pathway using the MetX and MetY enzymes, we cloned four different metY/X gene pairs to complement the ΔmetAB methionine auxotroph bacteria. The selection of metY/X gene pairs was based on a previously characterized dataset of MetX enzymes from various bacteria [31]. We applied two criteria to select the strains. First, the MetX enzymes should exhibit a range of catalytic activity between 103 and 104 nmol·min− 1·mg− 1 (of O-acetyl L-homoserine formation). Second, the relevant bacterial genome should contain a sequence for the counterpart metY gene adjacent to the metX gene, indicating a mini operon of two genes with coordinated expression and function.

Based on the above rationale, we selected metY/metX pairs from four bacterial strains: (i) Corynebacterium glutamicum (CG), (ii) Leptospira interrogans (LI), (iii) Cyclobacterium marinum (CM) and (iv) Deinococcus geothermalis (DG). Our hypothesis was that higher activity of MetX could result in increased methionine production. To this end, we incorporated MetX and MetY from CM and DG which exhibit higher activity and from LI and CG, which shows lower activity [31]. The genes from LI and CG have been previously characterized and demonstrated to be expressed in E. coli [37, 38]. Table 1 summarizes the UniProt entry identifiers of each protein. Sequence identity between the various MetX and MetY proteins is provided in Table S1 of the supplementary information.

Table 1 UniProt identifiers of the enzymes encoded by the genes used to complement the methionine auxotroph bacteria
Full size table

To design a uniform construct for expression in E. coli, the metX and metY genes were codon-optimized and cloned into a pCCl plasmid [40, 41] downstream to a synthetic constitutive promoter, a synthetic ribosome binding site (RBS) and followed by a synthetic terminator. At this stage, we maintained the gene arrangement as observed in the four different genomes, where metX is consistently positioned after metY. The synthetic promoter ensured constitutive expression, and the use of the pCCI plasmid enabled the maintenance of the inserted genes at low to a single-copy number, similar to the genomic copy number of the corresponding genes. To facilitate a comparison and ensure similar regulation, we also constructed a similar plasmid harboring the wild-type metAB genes of E. coli. This allowed us to assess complementation from the same genetic construct under comparable regulatory conditions, enabling a reliable and informative analysis. Figure 3A shows a schematic illustration of the constructed operon. The complete gene sequences and their accession numbers are depicted in the supplementary information. Following the transformation of the auxotroph bacteria with the plasmids, we evaluated the ability of the complemented ΔmetAB strain to grow in a liquid minimal MOPS medium. As shown in Fig. 3B, the methionine auxotroph ΔmetAB bacteria was successfully complemented with metY/X from DG and CM (ΔmetAB-DG and ΔmetAB-CM, respectively) and reached a similar growth rate and final cell density as those of the WT after ~ 800 min. The complemented bacteria carrying metY/X of LI and CG (ΔmetAB-LI and ΔmetAB-CG in Fig. 3B) did not grow under these conditions. Moreover, the plasmid carrying the wild-type metA/B ((ΔmetAB-AB) shows somewhat slower growth. Similar growth patterns were observed on minimal medium agar plates (Fig. 3C), indicating that the CM- and DG-complemented strains were able to produce methionine at levels sufficient to maintain their growth.

Fig. 3
figure 3

Complementation of ΔmetAB with metX/Y gene pairs. (A) Schematic illustration of the synthetic metYX operon on a low-copy plasmid used to complement ΔmetAB. A synthetic operon consisting of the metY and metX genes was constructed by adding a synthetic constitutive promoter, a ribosome binding site (RBS) for each gene, and a synthetic terminator. Restriction sites were included to facilitate rearrangement and analysis of mutant genes. (B) Growth curves of the complemented ΔmetAB strains on a minimal MOPS medium. WT: E. coli MG1655; ΔmetAB: WT with deletion of the metAB genes; ΔmetAB-DG/CM/LI/CG: ΔmetAB complemented with a pCCl plasmid expressing metX and metY of the indicated bacterial strain. ΔmetAB-AB: WT with deletion of the metAB genes complemented with a pCCl plasmid expressing E. coli’s metA and metB. (C.) Growth of the complemented ΔmetAB strains on a MOPS minimal-medium agar plate incubated at 37 °C for 24 h

Full size image

To quantify intracellular and extracellular methionine levels in the complemented bacteria, the methionine levels were evaluated using GC-MS and compared to those of the WT bacteria. The ΔmetAB-DG and ΔmetAB-CM strains exhibited a five-fold enhancement of intracellular methionine levels compared to WT (Fig. 4A). Analysis of the extracellular methionine in the growth medium indicated that ΔmetAB-DG exhibited significantly enhanced accumulation of extracellular methionine as compared to WT (18 fold). Although the difference in methionine accumulation was not significant in the ΔmetAB-CM strain compared to the control WT bacteria, its average obtained from four repeats also showed a five-fold increase (Fig. 4B).

Fig. 4
figure 4

Biosynthesis of methionine by E. coli ΔmetAB complemented with metY/X pairs. WT and complemented E. coli ΔmetAB were grown in a minimal MOPS medium at 37 °C for 24 h, after which the cells were separated from the growth medium. The amount of methionine in each fraction was evaluated using GC-MS. (A) Intracellular methionine accumulated by WT E. coli, ΔmetAB-DG and ΔmetAB-CM, reported as μg/ml. (B) Extra-cellular methionine accumulated in the growth media by WT E. coli, ΔmetAB-DG and ΔmetAB-CM, reported as μg/ml. Peak areas were normalized to ribitol internal control, and total methionine levels were calculated according to the standard methionine calibration curves. The results are presented as means ± SD of three to four replicates for each sample. Significance between WT and the different bacterial strain was calculated according to the Student’s t-test (P < 0.05) and is identified by an asterisk. The numbers on top of the bars indicate the fold increase relative to the WT in each panel

Full size image

Evaluation of intra- and extracellular methionine levels of E. coli with a deletion of metJ and overexpression of yjeH

After establishing E. coli strains expressing the metY/X of DG and CM in a ΔmetAB background, we further explored the effect of additional genetic variations related to the methionine biosynthetic pathway. More specifically, we deleted the gene encoding for the MetJ repressor that is known to strictly repress the transcription of multiple genes in the E. coli methionine biosynthetic pathway (metA, metB, metC, metE/H, Fig. 1) in response to elevated methionine levels [42, 43].

To evaluate the ability of the engineered strains to produce methionine, the bacteria were cultured in a minimal medium until reaching OD600 = 2.5. The intracellular and extracellular levels of methionine were evaluated using GC-MS (Fig. 5). Deletion of metJ on a WT background led to a 9-fold enhancement in the level of intracellular methionine relative to WT (Fig. 5A), while no change was detected in the extracellular methionine levels (Fig. 5B). Deletion of metJ on the ΔmetAB-CM background led to a 16- and 45-fold increase in intracellular and extracellular methionine levels, respectively, while in ΔmetABJ-DG, the levels increased by 11- and 95-fold, respectively, relative to WT (Fig. 5A-B).

To further increase methionine levels in the growth medium and reduce the level of inhibition on methionine-feedback sensitive enzymes or regulators, we also targeted the E. coli methionine exporter protein YjeH. This exporter was shown to have a strong positive effect on extracellular methionine accumulation and to reduce the methionine content inside the bacterial cells [18]. Therefore, its gene was cloned to facilitate overexpression and to enable enhanced methionine efflux to the medium. The metY/X plasmid carrying metY/X from DG or CM was than introduced into ΔmetABJ-Y, resulting in ΔmetABJ-Y-CM and ΔmetABJ-Y-DG. This procedure led to similar intracellular methionine levels as in ΔmetAB-CM and ΔmetABJ-DG, but it significantly increased the levels of extracellular methionine by 161- and 127-fold, respectively, relative to WT (Fig. 5B). Overall, methionine levels (combining the intra and extracellular methionine) increased by up to 31-fold over the WT and reached up to 700 μg/ml (Fig. 5C).

Fig. 5
figure 5

Production of methionine by ΔmetABJ overexpressing YjeH and complemented by metY/X from CM or DG. Comparison of: (A) intracellular; (B) extracellular; and (C) total methionine levels that were quantified by GC-MS. Peak areas were normalized to ribitol internal control, and total methionine levels were calculated according to the standard methionine calibration curves. The results are presented as means ± SD of three or four replicates for each sample. Significance between bacterial strains was calculated according to the Tukey’s HSD test (p < 0.05) and is identified by different small letters. The numbers on top of the bars in each panel indicate the fold-increase relative to the WT in each panel

Full size image

Bioavailability of extracellular methionine secreted from the engineered ΔmetABJ-Y-DG and ΔmetABJ-Y -CM strains and its potential use as a methionine supplement

To confirm the bioavailability of the extracellular methionine secreted from each engineered strain using an orthogonal approach, we collected the spent medium at the end of the bacterial growth phase of each strain and filtered it through a 0.22 μm membrane. The filtered spent medium was then added to a fresh methionine-free minimal MOPS medium at a 1:1 ratio. Thus, methionine could only be delivered from the filtered spent medium (Fig. 6A). The mixed medium was then evaluated for its ability to support the growth of ΔmetAB auxotroph. Figure 6 shows the growth curves of the ΔmetAB auxotroph bacteria grown in the mixed medium originated from the spent medium of the DG- (Fig. 6B) and CM- (Fig. 6C) complemented strains and compered to the mixed medium originated from the spent medium of ΔmetAB-WT. The highest cell density was observed when the ΔmetAB auxotroph was cultured with spent medium originating from ΔmetABJ-Y-CM/DG, suggesting that this strain exported the highest methionine levels. On the other hand, the ΔmetAB auxotroph did not grow with medium originated from the WT, indicating for the lack of methionine in its medium. Both results are congruent with the methionine levels that were measured for these strains using GC-MS (Fig. 5).

Fig. 6
figure 6

Growth curves of methionine-auxotrophE. coli in spent medium of each strain. (A) Illustration of the experimental scheme used to evaluate methionine level in the medium following the growth of each strain. (B) Growth curves in medium from DG strains. (C) Growth curves in medium from CM strains. All curves show the growth of the auxotroph E. coli ΔmetAB in fresh MOPS minimal medium supplemented with spent and filtered medium following the growth of the indicated strains

Full size image

Discussion

Various microbial cells are utilized to produce amino acids [44]. Among them, E. coli has gained significant attention as a promising organism for enhancing the bioproduction of natural amino acids, including L-methionine [45,46,47,48,49]. Despite numerous studies and significant advances in exploiting the potential of E. coli in this regard, the efficient production of L-methionine through bacterial fermentation remains a challenge. Previous studies focused primarily on metabolic engineering of E. coli W3110, achieved significant methionine levels of up to 18 g/L by utilizing medium supplemented with yeast extract and vitamins [22, 48]. In our present study, we relied on MOPS minimal medium and utilized E. coli MG1655 [9, 17], a closely related strain that has demonstrated its potential as a robust producer of bioproducts and has been interchangeably used with E. coli W3110 in various studies [50,51,52].

Regardless of the bacterial strain, efforts to enhance methionine levels in E. coli mostly involve the engineering of multifaceted cellular pathways that aim to release negative feedback regulation alongside optimizing the utilization of methionine precursors. While this strategy has resulted in significant improvements, it relies on harnessing the natural trans-sulfurylation pathway of E. coli. Methionine biosynthesis by the direct-sulfurylation pathway is much more abundant in the bacterial kingdom. However, it has been characterized in a relatively limited number of strains [24]. Moreover, only limited data is available on the catalytic properties of the central MetY enzymes [33, 53, 54] and their related 3D structures [28, 55,56,57].

Enzymes of the direct-sulfurylation pathways are versatile and can process various substrates [25, 26]. Indeed, previous studies showed that E. coli can grow with such enzymes [36, 38]. Thus, the current study aimed to replace the natural enzymes in E. coli with their counterpart from the direct-sulfurylation pathway. To that end, we explored the ability to complement the methionine auxotroph ΔmetAB strain with metX and metY enzymes from various bacteria completely forming direct-sulfurylation within the E. coli. The heart of the effort involved replacing the enzymes HST and CgS with HAT and OAHS. We inserted the genes encoding MetX (HAT) and MetY (OAHS) into the methionine auxotroph strain via a plasmid containing a synthetic mini operon of metY followed by metX (Fig. 3A). The transformation of the auxotrophic strain with a plasmid carrying the metY/X genes from DG and CM allowed for bacterial growth without the external addition of methionine. On contrary, the insertion of metX and metY from CG and LI failed to complement the methionine auxotroph E. coli. Of note, these enzymes were previously reported to complement DmetA methionine auxotroph bacteria with metXY from CG [38] or a DmetAB methionine auxotroph bacteria, with metXY from LI, however, in this particular case, the complementation occurred with a slow generation time [39]. This difference could be due to these enzymes’ reduced efficiency compared to the enzymes of DG and CM. However, it is possible that the activity of these enzymes requires additional co-factors and/or certain conditions that are not present in the context of the trans-sulfurylation pathway within E. coli. An additional explanation could be that a decreased expression level, misfolding leading to protein aggregation or faster degradation, contributed to the inability of the bacteria to grow. Regardless of the exact mechanism, this finding suggests that large variability exists in the activity of the different enzymes when complemented into E. coli. Therefore, the screening of additional genes from multiple organisms may further benefit methionine accumulation.

Several mechanisms could explain the higher methionine accumulation in the strains complemented with enzymes from the DG and CM strains relative to the WT containing the metA and metB genes on the same construct (Fig. 6B-C). E. coli employs stringent regulation mechanisms to tightly control methionine production. This regulation takes place at the DNA level, involving specific transcription factors like metJ, and through the inhibition of protein activity by methionine or related metabolites such as SAM. In our study, we introduced MetX and MetY genes under the control of a constitutive promoter that remains unaffected by changes in methionine concentration. Furthermore, it is possible that the MetX and MetY enzymes display reduced sensitivity to inhibition, as suggested by Bourhy et al. [36]. However, it is worth noting that other genes in the methionine pathway may still be susceptible to inhibition by methionine and related metabolites. Consequently, this limitation could contribute to a modest increase in intracellular methionine concentrations [14, 17]. Our results indicate that accumulation of methionine beyond a certain threshold, leads to methionine export outside of the cell (Fig. 4). Indeed, deletion of metJ resulted in higher methionine biosynthesis in the WT strain, showing that the release of regulation at the transcription level is an important factor for enhancing methionine biosynthesis [9, 14]. Without the transcriptional regulation in the ΔmetJ strain, deletion of metA and metB together with complementation with metX and metY (ΔmetABJ-DG/CM) further pushed the levels of methionine above those found in ΔmetAB-DG/CM. This finding could be due to the higher rate of enzymatic activity of metX in comparison to the rate-limiting enzyme metA in the trans-sulfurylation pathway [31] in addition to the reduced regulation of other important genes in the pathway, such as metE and metH (Fig. 1). Indeed, it was previously shown that MetX from LI expressed in E. coli was not affected by feedback inhibition imparted by high levels of methionine or SAM [36]. Of note, the higher levels of methionine observed in the ΔmetABJ-Y-CM compared to ΔmetABJ-CM suggest that excess of methionine inside the cells is controlled by other factors, some of which are yet unknown. Indeed, when the YjeH transporter was overexpressed, it enhanced the cells efflux and enabled the bacteria to produce more methionine.

The enhancement of methionine biosynthesis in the engineered E. coli warrants screening of additional MetX and MetY enzymes of other strains, to further characterize their ability to support methionine production. In addition, it may be possible to boost methionine levels by optimizing growth conditions with alternative sulfur sources and introducing additional modifications to the direct-sulfurylation pathway that aim to enhance metabolic flux and methionine export. Discovery of additional factors and their subsequent genetic alteration may further increase levels of methionine. These alterations can be achieved by classical strain improvement, using inhibitors such as norleucine, or by building new genetic circuits to control the expression of relevant genes. Our results show that the MetAB enzymes could be a limiting step in methionine biosynthesis regardless of additional modifications applied to the cell, and that the use of direct-sulfurylation MetYX enzymes dramatically enhanced methionine production (Fig. 5).

Additionally, our findings demonstrate that through the substitution of trans-sulfurylation with direct-sulfurylation, elevated levels of methionine can be exported and accumulated in the growth medium. This bioavailable methionine successfully supported the growth of the ΔmetAB auxotroph bacteria and thus has promising applications in fields such as animal feed and mammalian cell culture cultivation. Notably, while the direct-sulfurylation pathway demonstrates versatility in processing sulfur sources, our study focused specifically on using potassium sulfate (K2SO4) as the main sulfur source at moderate concentrations. This exploited E. coli’s ability to convert it into sulfide (S2−). Consequently, further investigation is needed to assess the impact of alternative, non-limiting, inorganic sulfur sources such as sulfide and sulfite on growth rate and extra cellular methionine levels. Moreover, it will provide valuable insights into sulfur assimilation in the methionine biosynthesis pathway. As such, these findings pave the way for further advancements in the utilization of E. coli for producing L-methionine.

Conclusions

Harnessing E. coli to produce L-methionine presents a promising avenue for enhanced production; however, it necessitates the modification of numerous regulatory and enzymatic bottlenecks throughout the biosynthetic pathway. Our findings suggest that by substituting the trans-sulfurylation metA and metB genes with the direct-sulfurylation metX and metY genes, methionine production in minimal medium can be significantly enhanced up to 700 mg/L.

Materials and methods

Bacterial strains and growth conditions

The E. coli strain MG1655 is referred to as the WT strain and was used in this study for all genetic manipulation. The bacteria were routinely grown in a lysogeny broth (LB) medium at 37 °C. For screening of the genetic variants, bacteria were grown in liquid or solid (supplemented with 1.5% agar) MOPS medium [58] (8.37 g/L MOPS, 0.71 g/L Tricine, 0.51 g/L NH4Cl, 0.05 g/L K2SO4, 2.92 g/L NaCl, 2.8 mg/L FeSO4, 0.074 mg/L CaCl2, 0.1 g/L MgCl2, 1 ml/L trace elements, 0.23 g/L K2HPO4, 2 g/L glucose, pH 7.3).

Generation of methionine auxotrophic mutants

All primers used in this study are listed in the supplementary information (Table S2). Genes in MG1655 were deleted by the lambda red recombinase procedure [59], with the pKD4 plasmid carrying the KnR cassette serving as a template for PCR reactions. Mutations were verified using nearby locus-specific primers (Table S2), with the respective primers k2 or kt. Afterwards, the cassette was removed, and double/triple knockouts were further generated using a similar approach. Knockouts were generated in the following order ΔmetA→ΔmetB→ΔmetJ, to form the bacterial strains ΔmetA, ΔmetAB and ΔmetABJ.

Complementation with a plasmid carrying the metX/Y genes

Electrocompetent ΔmetAB/ΔmetABJ mutants were transformed with the pCCI plasmid carrying the metXY synthetic operon. Following transformation, several colonies growing on LB agar plates supplemented with 30 μg/ml chloramphenicol were tested for the presence of the correct plasmid by colony PCR, with M13F and M13R primers. Positive clones were further screened for their ability to grow in methionine-depleted minimal media (MOPS). Briefly, cultures were prepared by inoculating a 5 ml MOPS medium with a single colony grown on LB plates and incubating it overnight at 37 °C (constant orbital shaking 200 rpm). The culture was diluted 1,000-fold in a fresh MOPS medium, and 200 μl were then placed in each well of a 96-well plate (Costar). Bacteria were grown for 20 h, at 37 °C (constant orbital shaking 280 rpm), and OD600 was measured every 16 min, using an Infinite M200 Plate Reader (Tecan). Each sample was tested in triplicates. For control, the MOPS medium was supplemented with 5–50 μg/ml methionine (Merck). Alternatively, a single colony grown on the LB medium was spread on MOPS agar plates, and growth following 24–72 h incubation at 37 °C was visually inspected.

Construction of a yjeH overexpression plasmid

The yjeH gene was amplified from genomic DNA extracted from E. coli MG1655 using a forward primer that adds an NcoI restriction site (GCGCCATGGATGAGTGGACTCAAACAAGAAC) and a reverse primer adding an XhoI restriction site (GCGCTCGAGTTATGTGGTTATGCCATTTTCC). The purified PCR product was digested with NcoI and XhoI and inserted into pTrcHis-a digested with the same enzymes. The correct construct was validated by sequencing.

Qualitative evaluation of extracellular methionine levels

For qualitative analysis of the methionine concentration in the medium, WT and methionine producing mutants were grown overnight at 37 °C in a 5 ml MOPS medium and filtered through a 0.22 μm membrane to remove bacterial cells. The filtered cell-free medium was diluted two-fold in a fresh MOPS medium containing no methionine, ensuring all methionine in the new medium was secreted by the original bacteria. The new medium was tested for its ability to support the growth of a ΔmetAB mutant in a minimal MOPS medium. Growth rate was determined by OD600 measurement.

Methionine extraction from lysate and medium to evaluate intra- and extra-cellular methionine levels

To evaluate the intracellular level of methionine, amino acids were extracted from cell pellets after centrifugation of 1 ml bacterial culture, using methanol:water:chloroform at a ratio of 1:1:2.5. After centrifugation, the crude extract was separated into polar and nonpolar phases by adding 300 μl water and 300 μl chloroform and centrifuging for 10 min. A 400 μl sample from the top polar phase were vacuum-dried. To evaluate extracellular methionine levels, amino acids were extracted from 500 μl of the bacterial culture medium by adding 500 μl chloroform and centrifuging for 10 min. A 400 μl sample from the upper polar phase was vacuum-dried. The latter fraction was dissolved in 40 μl of 20 mg/ml of methoxyamine hydrochloride in pyridine and incubated at 37 °C for 2 h with vigorous shaking, followed by derivatization for 30 min in N-methyl-N(trimethylsilyl)-trifluoroacetamide at 37 °C. One μl from each sample was used for methionine-level analysis, using GC-MS.

Evaluation of methionine levels by GC-MS

GC-MS analyses were carried out on Agilent 7890 A GC-MS coupled with a mass selective detector (Agilent 5975c), a Gerstel multipurpose sampler (MPS2), and equipped with a BP5MS capillary column (SEG; 30 m, 0.25-mm i.d., and 0.25-mm thick). For free amino acid detection, the single-ion mass method was used. Amino acid standards of 5,10, 25, 50, 100 and 200 μM were used to generate standard calibration curves, and ribitol (2 mg/ml in HPLC-grade water) was used as an internal standard. Peak areas were calculated from the standard calibration curves and normalized to the ribitol signal.

Bacterial strains and plasmids used in this study

Table 2 shows the different engineered strains and the terminology used in this study.

Table 2 Bacterial strains used in the study
Full size table

Data Availability

The authors confirm that all of this study data are available within the article and its supplementary information.

References

  1. Pasamontes A, Garcia-Vallve S. Use of a multi-way method to analyze the amino acid composition of a conserved group of orthologous proteins in prokaryotes. BMC Bioinformatics. 2006;7:257.

    PubMed  PubMed Central  Google Scholar 

  2. Bigelow DJ, Squier TC. Redox modulation of cellular signaling and metabolism through reversible oxidation of methionine sensors in calcium regulatory proteins. Biochim Biophys Acta. 2005;1703:121–34.

    PubMed  CAS  Google Scholar 

  3. Valley CC, Cembran A, Perlmutter JD, Lewis AK. Others: the methionine-aromatic motif plays a unique role in stabilizing protein structure. J Biol 2012.

  4. Cantoni GL. S-Adenosylmethionine; a new intermediate formed enzymatically from L-methionine and adenosinetriphosphate. J Biol Chem. 1953;204:403–16.

    PubMed  CAS  Google Scholar 

  5. Gophna U, Bapteste E, Doolittle WF, Biran D, Ron EZ. Evolutionary plasticity of methionine biosynthesis. Gene. 2005;355:48–57.

    PubMed  CAS  Google Scholar 

  6. Liu G, Magnuson AD, Sun T, Tolba SA, Starkey C, Whelan R, Lei XG. Supplemental methionine exerted chemical form-dependent effects on antioxidant status, inflammation-related gene expression, and fatty acid profiles of broiler chicks raised at high ambient temperature1. J Anim Sci. 2019;97:4883–94.

    PubMed  PubMed Central  Google Scholar 

  7. Brosnan JT, Brosnan ME. The sulfur-containing amino acids: an overview. J Nutr. 2006;136:1636S–40.

    PubMed  CAS  Google Scholar 

  8. Figge RM. Methionine biosynthesis in Escherichia coli and Corynebacterium glutamicum. Amino acid biosynthesis ~ pathways, Regulation and Metabolic Engineering. Berlin, Heidelberg: Springer Berlin Heidelberg; 2006: 163–93.

    Google Scholar 

  9. Li H, Wang BS, Li YR, Zhang L, Ding ZY, Gu ZH, Shi GY. Metabolic engineering of Escherichia coli W3110 for the production of L-methionine. J Ind Microbiol Biotechnol. 2017;44:75–88.

    PubMed  CAS  Google Scholar 

  10. Becker J, Wittmann C. Systems and synthetic metabolic engineering for amino acid production - the heartbeat of industrial strain development. Curr Opin Biotechnol. 2012;23:718–26.

    PubMed  CAS  Google Scholar 

  11. Shim J, Shin Y, Lee I, Kim SY. L-Methionine production. Adv Biochem Eng Biotechnol. 2017;159:153–77.

    PubMed  CAS  Google Scholar 

  12. Willke T. Methionine production–a critical review. Appl Microbiol Biotechnol. 2014;98:9893–914.

    PubMed  CAS  Google Scholar 

  13. Nakamori S, Kobayashi S, Nishimura T, Takagi H. Mechanism of l -methionine overproduction by Escherichia coli: the replacement of Ser-54 by asn in the MetJ protein causes the derepression of l -methionine biosynthetic enzymes. Appl Microbiol Biotechnol. 1999;52:179–85.

    PubMed  CAS  Google Scholar 

  14. Usuda Y, Kurahashi O. Effects of deregulation of methionine biosynthesis on methionine excretion in Escherichia coli. Appl Environ Microbiol. 2005;71:3228–34.

    PubMed  PubMed Central  CAS  Google Scholar 

  15. Maier T, Winterhalter C, Pfeiffer K. Method for fermentative production of L-methionine. In US patent (Uspto ed.: Consortium fuer Elektrochemische Industrie GmbH; 2009.

  16. Sagong H-Y, Lee D, Kim I-K, Kim K-J. Rational Engineering of Homoserine O-Succinyltransferase from Escherichia coli for reduced feedback inhibition by methionine. J Agric Food Chem. 2022;70:1571–8.

    PubMed  CAS  Google Scholar 

  17. Huang J-F, Liu Z-Q, Jin L-Q, Tang X-L, Shen Z-Y, Yin H-H, Zheng Y-G. Metabolic engineering ofEscherichia colifor microbial production of L-methionine. Biotechnol Bioeng. 2017;114:843–51.

    PubMed  CAS  Google Scholar 

  18. Liu Q, Liang Y, Zhang Y, Shang X, Liu S, Wen J, Wen T. YjeH is a Novel exporter of l-Methionine and branched-chain amino acids in Escherichia coli. Appl Environ Microbiol. 2015;81:7753–66.

    PubMed  PubMed Central  CAS  Google Scholar 

  19. Huang J-F, Shen Z-Y, Mao Q-L, Zhang X-M, Zhang B, Wu J-S, Liu Z-Q, Zheng Y-G. Systematic analysis of Bottlenecks in a Multibranched and Multilevel regulated pathway: the Molecular Fundamentals of l-Methionine biosynthesis in Escherichia coli. ACS Synth Biol. 2018;7:2577–89.

    PubMed  CAS  Google Scholar 

  20. Dischert W, Vasseur P, Boisart C, Figge R. Increasing NADPH availability for methionine production. US patent (Uspto ed.: METALBOLIC EXPLORER; 2015.

    Google Scholar 

  21. McCoy M. Evonik gets biobased methionine technology. C&EN Global Enterprise. 2016;94:13–3.

    Google Scholar 

  22. Zhou H-Y, Wu W-J, Niu K, Xu Y-Y, Liu Z-Q, Zheng Y-G. Enhanced L-methionine production by genetically engineered Escherichia coli through fermentation optimization. 3 Biotech. 2019;9:96.

    PubMed  PubMed Central  CAS  Google Scholar 

  23. Tang XL, Du XY, Chen LJ, Liu ZQ, Zheng YG. Enhanced production of L-methionine in engineered Escherichia coli with efficient supply of one carbon unit. Biotechnol Lett. 2020;42:429–36.

    PubMed  CAS  Google Scholar 

  24. Ferla MP, Patrick WM. Bacterial methionine biosynthesis. Microbiology. 2014;160:1571–84.

    PubMed  CAS  Google Scholar 

  25. Hacham Y, Gophna U, Amir R. In vivo analysis of various substrates utilized by cystathionine gamma-synthase and O-acetylhomoserine sulfhydrylase in methionine biosynthesis. Mol Biol Evol. 2003;20:1513–20.

    PubMed  CAS  Google Scholar 

  26. Foglino M, Borne F, Bally M, Ball G, Patte JC. A direct sulfhydrylation pathway is used for methionine biosynthesis in Pseudomonas aeruginosa. Microbiology. 1995;141(Pt 2):431–9.

    PubMed  CAS  Google Scholar 

  27. Vermeij P, Kertesz MA. Pathways of assimilative sulfur metabolism in Pseudomonas putida. J Bacteriol. 1999;181:5833–7.

    PubMed  PubMed Central  CAS  Google Scholar 

  28. Brewster JL, Pachl P, McKellar JLO, Selmer M, Squire CJ, Patrick WM. Structures and kinetics of Thermotoga maritima MetY reveal new insights into the predominant sulfurylation enzyme of bacterial methionine biosynthesis. J Biol Chem. 2021;296:100797.

    PubMed  PubMed Central  CAS  Google Scholar 

  29. Kawano Y, Suzuki K, Ohtsu I. Current understanding of sulfur assimilation metabolism to biosynthesize L-cysteine and recent progress of its fermentative overproduction in microorganisms. Appl Microbiol Biotechnol. 2018;102:8203–11.

    PubMed  CAS  Google Scholar 

  30. van der Ploeg JR, Eichhorn E, Leisinger T. Sulfonate-sulfur metabolism and its regulation in Escherichia coli. Arch Microbiol. 2001;176:1–8.

    PubMed  Google Scholar 

  31. Bastard K, Perret A, Mariage A, Bessonnet T, Pinet-Turpault A, Petit J-L, Darii E, Bazire P, Vergne-Vaxelaire C, Brewee C, et al. Parallel evolution of non-homologous isofunctional enzymes in methionine biosynthesis. Nat Chem Biol. 2017;13:858–66.

    PubMed  CAS  Google Scholar 

  32. Weissbach H, Brot N. Regulation of methionine synthesis in Escherichia coli. Mol Microbiol. 1991;5:1593–7.

    PubMed  CAS  Google Scholar 

  33. Hwang B-J, Park S-D, Kim Y, Kim P, Lee H-S. Biochemical analysis on the parallel pathways of methionine biosynthesis in Corynebacterium glutamicum. J Microbiol Biotechnol. 2007;17:1010–7.

    PubMed  CAS  Google Scholar 

  34. Seiflein TA, Lawrence JG. Two transsulfurylation pathways in Klebsiella pneumoniae. J Bacteriol. 2006;188:5762–74.

    PubMed  PubMed Central  CAS  Google Scholar 

  35. Sbodio JI, Snyder SH, Paul BD. Regulators of the transsulfuration pathway. Br J Pharmacol. 2019;176:583–93.

    PubMed  CAS  Google Scholar 

  36. Bourhy P, Martel A, Margarita D, Saint Girons I, Belfaiza J. Homoserine O-acetyltransferase, involved in the Leptospira meyeri methionine biosynthetic pathway, is not feedback inhibited. J Bacteriol. 1997;179:4396–8.

    PubMed  PubMed Central  CAS  Google Scholar 

  37. Ochrombel I, Fischer D, Bathe B, Hasselmeyer M, Hampel M, Pedall J. Method for producing l-methionine (Gmbh ED ed., vol. WO2017089077A12017.

  38. Schipp CJ, Ma Y, Al-Shameri A, D’Alessio F, Neubauer P, Contestabile R, Budisa N. Di salvo ML: an Engineered Escherichia coli strain with synthetic metabolism for in-cell production of translationally active methionine derivatives. ChemBioChem. 2020;21:3525–38.

    PubMed  PubMed Central  CAS  Google Scholar 

  39. Belfaiza J, Martel A, Margarita D, Saint Girons I. Direct sulfhydrylation for methionine biosynthesis in Leptospira meyeri. J Bacteriol. 1998;180:250–5.

    PubMed  PubMed Central  CAS  Google Scholar 

  40. Venkova-Canova T, Pátek M, Nesvera J. Characterization of the cryptic plasmid pCC1 from Corynebacterium callunae and its use for vector construction. Plasmid. 2004;51:54–60.

    PubMed  CAS  Google Scholar 

  41. Wild J, Hradecna Z, Szybalski W. Conditionally amplifiable BACs: switching from single-copy to high-copy vectors and genomic clones. Genome Res. 2002;12:1434–44.

    PubMed  PubMed Central  CAS  Google Scholar 

  42. Saint-Girons I, Duchange N, Cohen GN, Zakin MM. Structure and autoregulation of the metJ regulatory gene in Escherichia coli. J Biol Chem. 1984;259:14282–5.

    PubMed  CAS  Google Scholar 

  43. Augustus AM, Sage H, Spicer LD. Binding of MetJ repressor to specific and nonspecific DNA and effect of S-adenosylmethionine on these interactions. Biochemistry. 2010;49:3289–95.

    PubMed  CAS  Google Scholar 

  44. Hirasawa T, Shimizu H. Recent advances in amino acid production by microbial cells. Curr Opin Biotechnol. 2016;42:133–46.

    PubMed  CAS  Google Scholar 

  45. Mohany NAM, Totti A, Naylor KR, Janovjak H. Microbial methionine transporters and biotechnological applications. Appl Microbiol Biotechnol. 2021;105:3919–29.

    PubMed  PubMed Central  CAS  Google Scholar 

  46. Wendisch VF. Metabolic engineering advances and prospects for amino acid production. Metab Eng. 2020;58:17–34.

    PubMed  CAS  Google Scholar 

  47. Sanchez S, Rodríguez-Sanoja R, Ramos A, Demain AL. Our microbes not only produce antibiotics, they also overproduce amino acids. J Antibiot 2017.

  48. Niu K, Fu Q, Mei ZL, Ge LR, Guan AQ, Liu ZQ, Zheng YG. High-level production of l-Methionine by dynamic deregulation of metabolism with Engineered Nonauxotroph Escherichia coli. ACS Synth Biol. 2023;12:492–501.

    PubMed  CAS  Google Scholar 

  49. Shen ZY, Wang YF, Wang LJ, Wang Y, Liu ZQ, Zheng YG. Local metabolic response of Escherichia coli to the module genetic perturbations in l-methionine biosynthetic pathway. J Biosci Bioeng. 2023;135:217–23.

    PubMed  CAS  Google Scholar 

  50. Hayashi K, Morooka N, Yamamoto Y, Fujita K, Isono K, Choi S, Ohtsubo E, Baba T, Wanner BL, Mori H, Horiuchi T. Highly accurate genome sequences of Escherichia coli K-12 strains MG1655 and W3110. Mol Syst Biol. 2006;2:20060007.

    Google Scholar 

  51. Khankal R, Luziatelli F, Chin JW, Frei CS, Cirino PC. Comparison between Escherichia coli K-12 strains W3110 and MG1655 and wild-type E. coli B as platforms for xylitol production. Biotechnol Lett. 2008;30:1645–53.

    PubMed  CAS  Google Scholar 

  52. Monk JM, Koza A, Campodonico MA, Machado D, Seoane JM, Palsson BO, Herrgard MJ, Feist AM. Multi-omics quantification of Species Variation of Escherichia coli Links Molecular features with strain phenotypes. Cell Syst. 2016;3:238–251e212.

    PubMed  PubMed Central  CAS  Google Scholar 

  53. Kulikova VV, Anufrieva NV, Kotlov MI, Morozova EA, Koval VS, Belyi YF, Revtovich SV, Demidkina TV. O-acetylhomoserine sulfhydrylase from Clostridium novyi. Cloning, expression of the gene and characterization of the enzyme. Protein Expr Purif. 2021;180:105810.

    PubMed  CAS  Google Scholar 

  54. Kulikova VV, Revtovich SV, Bazhulina NP, Anufrieva NV, Kotlov MI, Koval VS, Morozova EA, Hayashi H, Belyi YF, Demidkina TV. Identification of O-acetylhomoserine sulfhydrylase, a putative enzyme responsible for methionine biosynthesis in Clostridioides difficile: gene cloning and biochemical characterizations. IUBMB Life. 2019;71:1815–23.

    PubMed  CAS  Google Scholar 

  55. Imagawa T, Utsunomiya H, Tsuge H, Ebihara A, Kanagawa M, Nakagawa N, Kuroishi C, Agari Y, Kuramitsu S, Yokoyama S. Crystal structure of O-actetyl Homoserine Sulfhydrylase from Thermus Thermophilus HB8,OAH2. 2007.

  56. Imagawa T, Kousumi Y, Tsuge H, Utsunomiya H, Ebihara A, Nakagawa N, Yokoyama S, Kuramitsu S, Initiative RSGP. Crystal structure of o-acetyl homoserine sulfhydrylase from Thermus thermophilus HB8. 2005.

  57. Tran TH, Krishnamoorthy K, Begley TP, Ealick SE. A novel mechanism of sulfur transfer catalyzed by O-acetylhomoserine sulfhydrylase in the methionine-biosynthetic pathway of Wolinella succinogenes. Acta Crystallogr D Biol Crystallogr. 2011;67:831–8.

    PubMed  PubMed Central  CAS  Google Scholar 

  58. Neidhardt FC, Bloch PL, Smith DF. Culture medium for enterobacteria. J Bacteriol. 1974;119:736–47.

    PubMed  PubMed Central  CAS  Google Scholar 

  59. Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000;97:6640–5.

    PubMed  PubMed Central  CAS  Google Scholar 

Download references

Funding

This research was supported by the Israeli Ministry of Agriculture (grant# 21-36-0003).

Author information

Authors and Affiliations

  1. Migal - Galilee Research Institute, Kiryat Shmona, 11016, Israel

    Nadya Gruzdev, Yael Hacham, Hadar Haviv, Itai Bloch, Rachel Amir & Itamar Yadid

  2. Department of Oral Biology, Goldschleger School of Dental Medicine, Faculty of Medicine, Tel Aviv University, Tel Aviv, 6997801, Israel

    Inbar Stern, Matan Gabay & Maayan Gal

  3. Tel-Hai College, Upper Galilee, 1220800, Israel

    Yael Hacham, Rachel Amir & Itamar Yadid

Authors
  1. Nadya Gruzdev
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yael Hacham
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Hadar Haviv
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Inbar Stern
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Matan Gabay
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Itai Bloch
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Rachel Amir
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Maayan Gal
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Itamar Yadid
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

N.G., Y.H., H.H., I.S., and M.G. performed the experimental research. Y.H. performed all mass-spec experiments. I.B. performed the bioinformatic analysis. N.G., Y.H., R.A., I.Y., and M.G. analyzed the data. Y.H., R.A., I.Y., and M.G. conceived of the research and wrote the manuscript. All authors reviewed and approved the manuscript.

Corresponding authors

Correspondence to Maayan Gal or Itamar Yadid.

Ethics declarations

Competing interests

All authors declares that they are the inventors of a patent related to improved methionine production by bacteria, described in this manuscript.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

. Table S1 - Sequence identity between the four selected MetX proteins and between the four selected MetY proteins. Table S2 - Primers used in this study. Supplementary text 1 -? Sequences of sythetic constructs and their assigned accession number.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Gruzdev, N., Hacham, Y., Haviv, H. et al. Conversion of methionine biosynthesis in Escherichia coli from trans- to direct-sulfurylation enhances extracellular methionine levels. Microb Cell Fact 22, 151 (2023). https://doi.org/10.1186/s12934-023-02150-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12934-023-02150-x

Keywords

Microbial Cell Factories

ISSN: 1475-2859

Contact us