Skip to main content

Artificial complementary chromatic acclimation gene expression system in Escherichia coli

Abstract

Background

The development of multiple gene expression systems, especially those based on the physical signals, such as multiple color light irradiations, is challenging. Complementary chromatic acclimation (CCA), a photoreversible process that facilitates the control of cellular expression using light of different wavelengths in cyanobacteria, is one example. In this study, an artificial CCA systems, inspired by type III CCA light-regulated gene expression, was designed by employing a single photosensor system, the CcaS/CcaR green light gene expression system derived from Synechocystis sp. PCC6803, combined with G-box (the regulator recognized by activated CcaR), the cognate cpcG2 promoter, and the constitutively transcribed promoter, the PtrcΔLacO promoter.

Results

One G-box was inserted upstream of the cpcG2 promoter and a reporter gene, the rfp gene (green light-induced gene expression), and the other G-box was inserted between the PtrcΔLacO promoter and a reporter gene, the bfp gene (red light-induced gene expression). The Escherichia coli transformants with plasmid-encoded genes were evaluated at the transcriptional and translational levels under red or green light illumination. Under green light illumination, the transcription and translation of the rfp gene were observed, whereas the expression of the bfp gene was repressed. Under red light illumination, the transcription and translation of the bfp gene were observed, whereas the expression of the rfp gene was repressed. During the red and green light exposure cycles at every 6 h, BFP expression increased under red light exposure while RFP expression was repressed, and RFP expression increased under green light exposure while BFP expression was repressed.

Conclusion

An artificial CCA system was developed to realize a multiple gene expression system, which was regulated by two colors, red and green lights, using a single photosensor system, the CcaS/CcaR system derived from Synechocystis sp. PCC6803, in E. coli. The artificial CCA system functioned repeatedly during red and green light exposure cycles. These results demonstrate the potential application of this CCA gene expression system for the production of multiple metabolites in a variety of microorganisms, such as cyanobacteria.

Introduction

For the development of bioprocesses using genetically modified bacteria, the physically controllable gene expression systems are recognized as an alternative to the conventional chemical induction system, considering the cost, waste, and recycling of cultivated media. Among several physical signals, light-based regulation is ideal for the regulation of cyanobacterial genes, considering the availability of various sensing systems. Therefore, optogenetics, which uses various photoreceptors to control cell behavior directly via light exposure, has recently attracted attention for synthetic biology-based bioprocess design. Cyanobacteria harbor various light-sensing systems [1,2,3,4,5,6]. Our research group is engaged in the design of microbial bioprocesses that can be controlled by the light signals, such as the CcaS/CcaR green sensing system derived from Synechocystis sp. PCC6803 (PCC6803) [7]. This system was successfully introduced into PCC6803 [8], the marine cyanobacterial strain Synechococcus sp. NKBG 15041c (NKBG 15041c), to regulate bioprocess using wavelength of marine cyanobacteria [9, 10], and non-photosynthetic bacteria E. coli [11]. Furthermore, CcaS was engineered [12] and successfully applied to cyanobacteria PCC6803 and NKBG 15041c [13].

One of the remarkable abilities of the cyanobacterial light-regulated gene expression system is the complementary chromatic acclimation (CCA), which enables cyanobacteria to change the protein or pigment composition of phycobilisomes and accessory light-harvesting complexes linked to photosystems during exposure to red and green light [14,15,16]. In CCA, cyanobacteria recognize and adapt their photosynthetic machinery to a wavelength of light by altering the phycobilisomes composition at the transcriptional level. Extensive studies have been carried out on the most representative cyanobacterial strain that displays CCA, Fremyella diplosiphon [14] (Additional file 1: Figure S1). The same system was also reported in the marine cyanobacterial strain Synechococcus sp. PCC7335 (PCC7335), which also shows type III CCA [17] (Scheme 1).

Scheme 1
scheme 1

CCA system with red and green light-regulated gene expression system, derived from Synechococcus sp. PCC7335 [17] with some modifications. a Under red light, RcaE, RcaF, and RcaC are phosphorylated. Phosphorylated RcaC binding to L-box within the promoter region activates pcyA and cpc2 transcription and represses pebAB transcription. b Under green light, RcaE, RcaF, and RcaC are dephosphorylated. Unphosphorylated RcaC does not bind to L-box; consequently, pcyA and cpc2 transcriptions are inactivated, and pebAB is transcribed

These studies have elucidated the molecular mechanism of type III CCA, which involves reversible photo-control under both red and green light. RcaE, RcaF, and RcaC protein are reportedly responsible for the regulation of type III CCA. Each protein plays a significant role in the regulation of both phycocyanin and phycoerythrin expression in a two-component regulatory system. RcaE functions as a sensor histidine kinase, and RcaF and RcaC function as cognate response regulators [4, 18,19,20,21,22,23]. Under red light, RcaE phosphorylates RcaC via RcaF, which binds to L-boxes in CCA-regulated promoters and activates the expression of red light-upregulated genes, including cpc2. Simultaneously, RcaC binds to L-box locates at the opposite orientation upstream of pebAB (green light-upregulated operon in PCC7335), at a greater distance from the transcription start site, and decreases the transcriptional activity and represses the expression of the key green light-upregulated operon, pebAB. Under the green light, RcaC is inactivated and cannot bind to L-boxes in CCA-regulated promoters nor activate red light-upregulated genes; simultaneously, RcaC cannot repress the expression of the key green light-upregulated operon, pebAB. Type III CCA recognizes and discriminates between green and red light environments using only one sensor histidine kinase, RcaE, which phosphorylates (activates) its cognate response regulator RcaC. Moreover, depending on the location of L-boxes in the promoters where activated RcaC binds, the promoter is activated or repressed [17]. The molecular mechanism of the type III CCA light-regulated gene expression regulation mechanism prompted us to design a dual light-regulated gene expression system by employing a single photosensor system to control gene expression in a recombinant microorganism.

In this study, we designed and developed an artificial CCA green and red light-regulated gene expression system, inspired by the type III CCA system in the cyanobacteria, using a single two-component regulated photosensor system, CcaS/CcaR, combined with a G-box inserted downstream of the promoters to mimic of type III CCA light-regulated gene expression (Scheme 2). We employed the CcaS/CcaR green light system derived from PCC6803 as the only photosensor. The rfp gene was inserted downstream, whereas the inherent CcaR binding site, G-box, was located upstream, of the cpcG2 promoter. The bfp gene was inserted downstream of the PtrcΔLacO and another G-box was inserted between PtrcΔLacO and bfp. Under the green light illumination (Scheme 2a), CcaS activates CcaR to bind to the G-box upstream of the cpcG2 promoter, thereby upregulating the transcription of rfp; activated CcaR is also able to bind to the G-box located between PtrcΔLacO and bfp, thereby downregulating the transcription of bfp. Under the red light illumination (Scheme 2b), CcaS inactivates and dephosphorylates CcaR, thereby releasing CcaR from G-boxes. Consequently, the transcription of rfp is downregulated, whereas the transcription of the bfp gene is upregulated.

Scheme 2
scheme 2

An artificial CCA system with green and red light-regulated dual gene expression system by employing a single photosensor, CcaS/CcaR, combined with G-box inserted upstream of promoters. a Under green light illumination, CcaS, a green light sensor, activates the response regulator CcaR. Activated CcaR binds to the G-boxes, and upregulates the cpcG2 promoter, consequently, the rfp  gene is transcribed. Simultaneously, CcaR binds to the G-box located between PtrcΔLacO and reporter gene, bfp, and downregulates the transcription of bfp. b Under red light illumination, CcaS inactivates and dephosphorylates CcaR. Inactivated CcaR is no longer able to bind to the G-boxes, and downregulates the cpcG2 promoter; consequently, the rfp gene is not transcribed. Simultaneously, CcaR does not bind to the G-box located between PtrcΔLacO and reporter gene, bfp, transcription under the PtrcΔLacO promoter is upregulated, and the bfp gene is transcribed

To realize the designed artificial CCA gene expression system, a plasmid vector was constructed encoding the gene components of artificial CCA. E. coli DH5α was used as the model microorganism, after transformation with the plasmid encoding the phycocyanobilin (PCB) synthesis gene cassette, to demonstrate the expression of red fluorescent protein and repression of blue fluorescent protein under green light illumination, and the repression of red fluorescent protein and expression of blue fluorescent protein under red light illumination, which were regulated at the transcriptional level.

Results

Construction of red light-regulated gene expression system using a green light sensor

First, we constructed a plasmid for the red light-regulated gene expression system, by mimicking the Rca system of the CCA system of PCC7335, but utilizing the CcaS/CcaR green light-sensing system of PCC6803 as the photosensor. The CcaS photoreceptor and cognate response regulator CcaR together with their native promoters were assembled with a strong PtrcΔLacO promoter, which was modified by inserting a G-box sequence, between PtrcΔLacO and the structural gene of a bfp as a reporter gene (BBa_K592024) [24]. The final construct, named pBR-RSS-bfp, functioned as a red light-regulated plasmid.

After 15 h of red light illumination, the transcription of the bfp reporter gene derived from the pBR-RSS-bfp plasmid reached its highest level of approximately 69.9 AU; this was 36.2-fold higher than that achieved under green light illumination (1.93 AU; Fig. 1a). To represent BFP at the translational, a fluorescence intensity assay was used. The fluorescence intensity of BFP was 7.35 AU/OD 595 nm after red light illumination; this was 8.75-fold higher than that after to green light illumination (0.84 AU/OD 595 nm). These results indicated that the constructed red light-regulated gene expression system functioned, and that gene expression was induced under red light but repressed under green light.

Fig. 1
figure 1

Evaluation of E. coli transformants harboring pBR-RSS-bfp after 15 h under red or green light. a Transcriptional analyses of the bfp gene normalized by 16S rRNA housekeeping gene. b Translational analysis using fluorescence assay; BFP is normalized by cell density at OD 595 nm. Data represent mean  ±  SD from three independent experiments

Construction and characterization of artificial CCA gene expression system

The artificial CCA gene expression system was constructed by inserting a red light sensor region (PtrcΔLacO-G box-bfp-Terminator), from the pBR-RSS-bfp plasmid, downstream of the rfp gene, from the previously constructed pBR-GSS-rfp plasmid [11], under the regulation, a single photosensor derived from two-component regulated photosensory system CcaS/CcaR green light-sensing system of PCC6803. The response of pBR-GSS-RSS plasmid, to red and green light illumination was evaluated, at the transcriptional and translational levels under pseudo-continuous cultivation [25].

After 18 h of cultivation at 30 °C, in an incubator shaker at 140 rpm, under dark light, the cells transformants was reached the exponential phase. Decreasing the temperature to 25 °C, and with media replacement every 12 h, the stationary phase was maintained until 54 h of the cultivation, at which point the transformants were exposed to the designated light illuminations.

The transcription of the rfp gene reached the highest level of 115.96 AU after 18 h of continuous green light illumination, which was 8.40-fold higher than that of the bfp gene (13.80 AU), (Fig. 2a). Additionally, the trend of RFP and BFP fluorescence intensity levels were consistent with these results, as RFP fluorescence intensity reached its highest at value 47.55 AU/OD 595 nm after 18 h of green light illumination, which was 8.05-fold higher than that of BFP fluorescence intensity (5.90 AU/OD 595 nm; Fig. 2b).

Fig. 2
figure 2

Transcriptional and translational analyses of each designated reporter gene from E. coli transformants harboring pBR-GSS-RSS. Under continuous green light illumination, a RNA transcript level of rfp and bfp reporter genes and b fluorescence analysis of RFP and BFP. Under continuous red light illumination, c RNA transcript level of rfp and bfp reporter genes and d: fluorescence analysis of RFP and BFP. The RNA transcript level was normalized by the 16S rRNA housekeeping gene and the fluorescence intensity was normalized by a cell density at OD 595 nm. Data represent mean  ±  SD from three independent experiments

In contrast, the transcription of the bfp reporter gene reached its highest level of 126 AU after 18 h of continuous red light illumination, which was 9.09-fold higher than that of the rfp gene (13.80 AU; Fig. 2c). Additionally, the BFP fluorescence intensity reached its highest value of 35.8 AU/OD 595 nm after 18 h of red illumination light induction, which was 4.06-fold higher than that of RFP fluorescence intensity (8.80 AU/OD 595 nm; Fig. 2d).

These results demonstrate that the designed and constructed artificial CCA gene expression system can regulate the expression of two genes under the red and green light using a single light sensor. Here, bfp gene expression was induced under red light while rfp gene expression was repressed, whereas rfp gene expression was induced under green light while bfp gene expression was repressed, as we expected.

Investigation of CCA under repeated red and green light illumination

Using pseudo-continuous cultivation conditions, the effect of the red and green light exposure cycles on the artificial CCA gene expression system were investigated. After 18 h of cultivation at 30 °C, in an incubator shaker at 140 rpm, under dark light and transformants reached the exponential phase, red light was applied and its effects at the transcriptional and translational levels were evaluated under pseudo-continuous cultivation conditions. The transcription of bfp reached level of 75.1 AU, after 6 h of red light illumination, which was 4.93-fold higher than that of the rfp gene (15.2 AU). When the light was changed to green light 6 h later, the level of bfp transcription decreased to 15.8 AU; in contrast, the level of the rfp transcription increased to 58.6 AU, or 3.69-fold higher than that of bfp. When the light was changed back to red 6 h later, the transcript level of bfp increased to 142 AU, and that of rfp decreased to 27.5 AU. This pattern was repeated until 54 h of illumination time (Fig. 3a).

Fig. 3
figure 3

Transcriptional and translational analyses of BFP and RFP from E. coli transformants harboring pBR-GSS-RSS under repeated red and green light illumination under pseudo-continuous cultivation conditions. a bfp and rfp RNA transcription level normalized by 16S rRNA housekeeping gene under repeated red and green light illumination. b Fluorescence intensity of BFP and RFP normalized by a cell density at OD 595 nm under repeated red and green light illumination. Data represent mean  ±  SD from three independent experiments

The trend was consistent at the translational level. After 6 h of red light illumination, the BFP fluorescence intensity reached 38.4 AU/OD 595 nm, which was 4.46-fold higher than the RFP fluorescence intensity (8.61 AU/OD 595 nm). When changed to green light 6 h later, the fluorescence intensity of BFP decreased to 11.9 AU/OD 595 nm and that of RFP increased to 41.3 AU/OD 595 nm. Moreover, when changed back to red light 6 h later, the BFP fluorescence intensity increased to 61.2 AU/OD 595 nm and RFP fluorescence intensity decreased to 13.7 AU/OD 595 nm. Overall, during the red and green light exposure cycles, the expression of BFP increased under red light exposure while that of RFP was repressed, and that of RFP increased under green light exposure while that of BFP was repressed, respectively (Fig. 3b).

Discussion

In this study, an artificial CCA gene expression system was developed using the CcaS/CcaR green light two-component regulation system derived from PCC6803. This was inspired by the single photosensor-based regulation of type III CCA reported in PCC7335, which is similar to that reported in F. diplosiphon [17], to achieve dual control of the light-regulated gene expression system in E. coli.

The constructed plasmid pBR-GSS-RSS consisted of rfp and bfp genes under the regulation of the green light-inducible promoter PcpcG2 [7] and constitutive strong PtrcΔLacO promoter [26], which were modified by adding a G-box sequence between the PtrcΔLacO and the reporter gene, bfp. The expression of rfp was induced by PcpcG2 under green light illumination and that of bfp was induced by the PtrcΔLacO promoter, modified by the addition of a G-box sequence, under red light illumination. Moreover, these effects were successfully observed using only a single photosensor.

The transcriptional level induced by cpcG2 promoter was seemed to be slower than the one in trcΔLacO promoter (Fig. 2a, c). By defining the normalized arbitrary unit (nAU), which is the proportion of AU at certain time compared with the maximum AU observed in the experiment (after 18 h of light induction), the speed of the transcription (dnAU/dt), is compared. The speed of the transcription at t  =  6 for cpcG2 promoter was 4.95 h−1, whereas the one for the trc∆LacO promoter was 5.29 h−1. These results confirm that the transcriptional level is slower in the cpcG2 promoter, compared with the one in the trc∆LacO promoter. This difference would be attributed to the differences of the (− 10) and (− 35) elements between cpcG2 promoter and trc∆LacO promoter. The (− 10) and (− 35) elements of trc∆LacO promoter harbors the E.coli derived (− 10) and (− 35) elements (5′-TATAAT-3′ and 5′-TTGACA-3′), which is the Type I promoter, typically recognized by sigma factor, σ70, of E. coli. In contrary, cpcG2 promoter (5′-ATTCAA-3′ and 5′-AACCGA-3′) is derived from cyanobacteria PCC6803, and lack σ70 promoter consensus sequence, therefore, the transcription of this exogenous promoter was slower than the one from trc∆LacO promoter [26, 27].

During cultivation under pseudo-continuous cultivation, the transcription level after 30 h decreased. The decrease in transcription might be attributed to the change of the status of the cells due to the low dilution rate we employed. The dilution rate achieved in this pseudo-continuous cultivation was 0.021 h−1, which was much lower than the maximum specific growth rate of E.coli observed in this study, which is 1.9 h−1 where the highest transcription would be kept. Under continuous cultivation, the specific growth rate will be synchronized with the dilution rate, therefore, under this pseudo-continuous cultivation, the status of the cells would be later log phase or stational phase, where the cellular activity including transcriptional activity gradually decreases.

The multichromatic control of a gene expression system in E. coli has been reported previously. The expression of the lacZ gene was regulated by utilizing two photosensors, an engineered Cph8 chimera and a cyanobacterial CcaS photoreceptor, and their respective response regulators, OmpR and CcaR [28, 29]. Although our current achievements were not directly compared with these-multi-sensor-based dual light-regulated gene expression systems, the utilization of a single photosensor, the CcaS/CcaR green light-sensing system derived from PCC6803 for the dual control of a light-regulated gene expression system, offers the benefit of more simpler plasmid circuit design, which will affect in the transcription factor involved as well as the regulation system, and be a significant contribution of this system.

The technology used in this study was designed for the application in the regulation of biosynthetic pathways that require multiplex control at different steps using different light colors. The results of this study hold great promise for application in cyanobacterial bioprocesses. The utilization of phytochrome-based family photoreceptors, will provide full control, and various light sensors connected to different transcription factors are available, which allows the multichromatic control of several transcription units using light [30,31,32]. Moreover, a light-based regulation system is beneficial, as neither additional expensive chemicals nor physical inducers are needed; thus, this system can be easily applied. A regulatory system that can be switched on and off by shifting two different light colors will facilitate a gene expression system that can be tightly regulated at specific times and locations.

Conclusions

In this study, an artificial CCA system was successfully developed to realize a multiple gene expression system, which was regulated by two colors, red and green lights, using a single photosensor, the CcaS/CcaR system derived from Synechocystis sp. PCC6803. The designed and constructed artificial CCA gene expression system regulated the expression of two genes, rfp, and bfp, under the red and green light; bfp expression was induced under red light while rfp expression was repressed, and rfp expression was induced under green light while bfp expression was repressed, as we expected. Moreover, the artificial CCA system functioned repeatedly during the red and green light exposure cycles; the expression of BFP increased under red light exposure while RFP was repressed, and that of RFP increased under green light exposure while that of BFP was repressed. These results demonstrate the potential application of this gene expression system for production of multiple metabolites in a varieties of microorganisms, including cyanobacteria.

Methods

Construction of plasmid encoding red light-regulated gene expression system

The gene encoding the blue fluorescent protein, bfp (BBa_K592024) followed by a terminator (BBa_B1006) derived from the BioBrick collection [24], was inserted downstream of the constitutive PtrcΔLacO promoter, by overlap PCR. The PtrcΔLacO promoter was modified by inserting a G-box sequence (CTTTCCGATTTCTTTACGATTT), upstream of the reporter gene, bfp. The PCR products were assembled corresponding to the BamHI and XbaI sites of pBR-GSS-rfp (Fig. 4a). pBR-GSS-rfp contains the CcaS/CcaR two-component green light-regulated system [11], and was digested with a similar restriction enzyme to omit the rfp gene under the regulation of the PcpcG2 promoter from the plasmid construction. The resulting plasmid was designated pBR-RSS-bfp (Fig. 4c), which was used as a control plasmid for red light illumination. Cloning was performed using E. coli DH5α as the host, and the pSTV-PCB plasmid [11] which encodes protein PCB production (Fig. 4b).

Fig. 4
figure 4

Plasmid used in this research. a pBR-GSS-rfp, encodes for rfp gene driven by PcpcG2 [12]. b pSTV-PCB, encodes protein PCB production [11]. c pBR-RSS-bfp, encodes bfp gene driven by PtrcΔLacO with an additional G-box upstream of the reporter gene, bfp. d pBR-GSS-RSS, encodes for rfp and bfp gene driven by PcpcG2 and PtrcΔLacO, respectively, with an additional G-box upstream of the reporter gene, bfp

Construction of plasmid encoding dual control of light-regulated gene expression system

A designated plasmid harboring dual control of the light-regulated system was constructed by inserting the PtrcΔLacO promoter, which has been modified as previously described in the Methods section, followed by the bfp gene encoding blue fluorescent protein (BBa_K592024) and a terminator (BBa_B1006), derived from BioBrick collection [24], downstream of the rfp gene corresponding to the BamHI and XbaI sites of pBR-GSS-rfp [12], carrying the CcaS/CcaR two-component regulation system from Synechocystis sp. PCC6803 (PCC6803) by overlap PCR. The final designated plasmid, pBR-GSS-RSS (Fig. 4d) was cloned using E. coli DH5α as the host and the pSTV-PCB plasmid [11], encoding protein PCB production. All constructed plasmids are shown in Fig. 4, and the components are described in Table 1.

Table 1 Plasmid construction use in this study

Evaluation of plasmid encoding for red light-regulated gene expression system

Transformants of E. coli harboring the plasmid encoding pBR-RSS-bfp were pre-cultured in tubes containing 2 mL of fresh LB broth medium with appropriate antibiotics (100 μg/mL ampicillin and 30 μg/mL chloramphenicol), at 37 °C, in an incubator shaker at 140 rpm, overnight in the dark. The cell culture was transferred to 20 mL of fresh LB broth medium with appropriate antibiotics, as described above, in 100-mL Erlenmeyer flasks with the initial optical density at 595 nm (OD 595 nm  =  0.02) and incubated at 30 °C, in an incubator shaker at 110 rpm, under dark conditions until they reached the exponential phase, which was confirmed at OD 595 nm. After cell growth reached the exponential phase, half of the culture was exposed to red light at an intensity of 40 μmol photon m−2 s−1, measured using a light meter (LI-250A, LI-COR, Bioscience) and the other half maintained under green light (40 μmol photon m−2 s−1). During cultivation, samples were withdrawn from the culture to evaluate the effect of the different colors at the transcriptional and translational levels.

Evaluation of CCA under repeated red and green light illumination

To investigate whether the CCA system functioned after repeated red and green light illumination, the effects of light on the constructed plasmid pBR-GSS-RSS was evaluated under pseudo-continuous conditions according to [25] with some modifications for E. coli. In a 500-mL Erlenmeyer flask, containing 150 mL of fresh LB medium with appropriate antibiotics (100 μg/mL ampicillin and 30 μg/mL chloramphenicol), transformants were cultivated at 30 °C, in an incubator shaker at 140 rpm, under the dark conditions until cell growth reached the exponential phase. After the transformants reached the exponential phase, cells were exposed to continuous red, continuous green, or repeated red and green (6 h of red light followed by 6 h of green light) light illumination. Every 12 h, 37.5 mL of culture was replaced with fresh medium containing appropriate antibiotics (100 μg/mL ampicillin and 30 μg/mL chloramphenicol). During cultivation, samples were withdrawn from the culture every 3 h to evaluate the effects of each condition on each designated reporter gene at the transcriptional and translational levels (Additional file 1: Figure S2).

Transcriptional analysis of rfp and bfp reporter gene by quantitative PCR (qPCR)

During cultivation, 1 mL of E. coli cells harboring pBR-RSS-bfp or pBR-GSS-RSS was periodically collected for RNA extraction. RNA was extracted by centrifugation at 4000×g for 10 min at 25 °C, using a TRI reagent base of chloroform phenol (Molecular Research Inc.). The isolated RNA was treated with DNase to remove genomic DNA and reverse transcribed into cDNA using a PrimeScript® RT reagent kit with gDNA Eraser (Takara Bio Inc.). qPCR was performed to measure the expression of rfp and bfp reporter genes and the 16S ribosomal RNA (rRNA) housekeeping genes of E.coli using SYBR® Premix Ex TaqTM II (Tli RNase H Plus, Takara Bio Inc.). The expression of these genes at the transcriptional level was analyzed using the ∆∆Ct method and normalized by calculating the expression of the 16S rRNA housekeeping gene.

Evaluation of red and green light-regulated protein expression

To monitor the RFP and BFP protein expression levels, 700 μL of each culture was periodically harvested and centrifuged at 12,000×g for 2 min at 25 °C, and the supernatant was discarded. Each cell pellet was resuspended in 200 μL of phosphate-buffered saline (PBS); this procedure was repeated twice. The resuspended cell pellet was transferred to a black 96-well plate. The fluorescence of each protein was measured using a plate reader (Variouskan flash spectral scanning microplate reader, Thermo Scientific) with excitation and emission wavelengths (RFP at 584 nm and 607 nm; BFP 399 nm and 456 nm, respectively). The cell density at OD 595 nm was measured after transferring 20 μL from each cell suspension to a clear 96-well plate and diluting with 180 μL of PBS.

Availability of data and materials

Not applicable.

References

  1. 1.

    Narikawa R, Suzuki F, Yoshihara S, Higashi S, Watanabe M, Ikeuchi M. Novel photosensory two-component system (PixA-NixB-NixC) involved in the regulation of positive and negative phototaxis of cyanobacterium Synechocystis sp. PCC6803. Plant Cell Physiol. 2011;52:2214–24.

    CAS  Article  Google Scholar 

  2. 2.

    Song JY, Cho HS, Cho JI, Jeon JS, Lagarias JC, Park YI. Near-UV cyanobacterichrome signaling system elicits negative phototaxis in the cyanobacterium Synechocystis sp. PCC6803. Proc Natl Acad Sci. 2011;108:10780–5.

    CAS  Article  Google Scholar 

  3. 3.

    Yoshihara S, Shimada T, Matsuoka D, Zikihara K, Kohchi T, Tokutomi S. Reconstruction of blue-green reversible photoconversion of cyanobacterial photoreceptor, PixJ1, in phycocyanobilin-producing Escherichia coli. Biochemistry. 2006;45:3775–84.

    CAS  Article  Google Scholar 

  4. 4.

    Terauchi K, Montgomery BL, Grossman AR, Lagarias JC, Kehoe DM. RcaE is complementary chromatic adaptation photoreceptor required for green and red responsiveness. Mol Microbiol. 2004;51:576–7.

    Article  Google Scholar 

  5. 5.

    Hirose Y, Shimada T, Narikawa R, Katayama M, Ikeuchi M. Cyanobacteriochrome CcaS is the green light receptor that induces the expression of phycobilisome linker protein. Proc Natl Acad Sci. 2008;105:9528–33.

    CAS  Article  Google Scholar 

  6. 6.

    Hirose Y, Narikawa R, Katayama M, Ikeuchi M. Cyanobacteriochrome CcaS regulates phycoerythrin accumulation in Nostoc punctiforme, a group II chromatic adapter. Proc Natl Acad Sci. 2010;107:8854–9.

    CAS  Article  Google Scholar 

  7. 7.

    Abe K, Miyake K, Nakamura M, Kojima K, Ferri S, Ikebukuro K, Sode K. Engineering of a green-light inducible gene expression system in Synechocystis sp. PCC6803. Microbial Biotechnol. 2014;7:177–83.

    CAS  Article  Google Scholar 

  8. 8.

    Miyake K, Abe K, Ferri S, Nakajima M, Nakamura M, Yoshida W, Kojima K, Ikebukuro K, Sode K. Green light-inducible lytic system for cyanobacterial cells. Biotechnol Biofuels. 2014;7:56.

    Article  Google Scholar 

  9. 9.

    Badary A, Abe K, Ferri S, Kojima K, Sode K. The development and characterization of an exogenous green-light-regulated gene expression system in marine cyanobacteria. Mar Biotechnol. 2015;17:245–51.

    CAS  Article  Google Scholar 

  10. 10.

    Badary A, Takamatsu S, Nakajima M, Ferri S, Lindblad P, Sode K. Glycogen production in marine cyanobacterial strain Synechococcus sp. NKBG 15041c. Mar Biotechnol. 2018;20:109–17.

    CAS  Article  Google Scholar 

  11. 11.

    Nakajima M, Abe K, Ferry S, Sode K. Development of light-regulated cell recovery system for non-photosynthetic bacteria. Microb Cell Fact. 2016;15:31.

    Article  Google Scholar 

  12. 12.

    Nakajima M, Ferri S, Rögner M, Sode K. Construction of a miniaturized chromatic acclimation sensor from cyanobacteria with reversed response to a light signal. Sci Rep. 2016;6:37595.

    CAS  Article  Google Scholar 

  13. 13.

    Kobayashi S, Nakajima M, Asano R, Ferreira EA, Abe K, Tamagnini P, Atsumi S, Sode K. Application of an engineered chromatic acclimation sensor for red light-regulated gene expression in cyanobacteria. Algal Res. 2019;44:101691.

    Article  Google Scholar 

  14. 14.

    Kehoe DM, Gutu A. Responding to color: the regulation of complementary chromatic adaptation. Annu Rev Plant Biol. 2006;57:127–50.

    CAS  Article  Google Scholar 

  15. 15.

    Gutu A, Kehoe DM. Emerging perspectives on the mechanism, regulation, and distribution of light color acclimation in cyanobacteria. Mol Plant. 2012;5:1–13.

    CAS  Article  Google Scholar 

  16. 16.

    Montgomery BL. Mechanism and fitness implications of photomorphogenesis during chromatic acclimation in cyanobacteria. J Exp Bot. 2016;67(14):4079–90.

    CAS  Article  Google Scholar 

  17. 17.

    Li L, Alvey RM, Bezy RP, Kehoe DM. Inverse transcriptional activities during complementary chromatic adaptation are controlled by the response regulator RcaC binding to red and green light-responsive promoters. Mol Microbiol. 2008;68(2):286–97.

    CAS  Article  Google Scholar 

  18. 18.

    Kehoe DM, Grossman AR. New classes of mutants in complementary adaptation provide evidence for a novel four-step phosphorelay system. J Bacteriol. 1997;179:3914–21.

    CAS  Article  Google Scholar 

  19. 19.

    Alvey RM, Karty JA, Roos E, Reilly JP, Kehoe DM. Lesions in phycoerythrin chromophore biosynthesis in Fremyella diplosiphon reveal coordinated light regulation of apoprotein and pigment biosynthetic enzyme gene expression. Plant Cell. 2003;15:2448–63.

    CAS  Article  Google Scholar 

  20. 20.

    Li L, Kehoe DM. In vivo analysis of the roles of conserved aspartate and histidine residues within a complex response regulator. Mol Microbiol. 2005;55:1538–52.

    CAS  Article  Google Scholar 

  21. 21.

    Alvey RM, Bezy RP. A light regulated OmpR-class promoter element co-ordinates light-harvesting protein and chromophore biosynthetic enzyme gene expression. Mol Microbiol. 2007;64(2):319–32.

    CAS  Article  Google Scholar 

  22. 22.

    Bordowitz JR, Montgomery BL. Photoregulation of cellular morphology during complementary chromatic adaptation requires sensor-kinase-class protein RcaE in Fremyella diplosiphon. J Bacteriol. 2008;190(11):4069–74.

    CAS  Article  Google Scholar 

  23. 23.

    Bezy RP, Kehoe DM. Functional characterization of cyanobacterial OmpR/PhoB class transcription factor binding site controlling light color responses. J Bacteriol. 2010;192(22):5923–33.

    CAS  Article  Google Scholar 

  24. 24.

    Registry of Standard Biological Part. https://www.partregistry.org.

  25. 25.

    Sode K, Hatano N, Tatara M. Pseudo-continuous culture of marine recombinant cyanobacteria under light and dark cycle. Biotechnol lett. 1994;16(9):973-6.

    CAS  Article  Google Scholar 

  26. 26.

    Huang HH, Camsund D, Lindblad P, Heidorn T. Design and characterization of molecular tools for synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Res. 2010;38:2577–93.

    CAS  Article  Google Scholar 

  27. 27.

    Camsund D, Linblad P. Engineered transcriptional system for cyanobacterial biotechnology. Front Bioeng Biotechnol. 2014;2:1–9.

    Article  Google Scholar 

  28. 28.

    Tabor JJ, Levskaya A, Voigt CA. Multichromatic control of gene expression in Escherichia coli. J Mol Biol. 2011;405:315–24.

    CAS  Article  Google Scholar 

  29. 29.

    Schmidl SR, Sheth RU, Wu A, Tabor JJ. Refactoring and optimization of light-switchable Escherichia coli two component systems. ACS Synth Biol. 2014;3:820–31.

    CAS  Article  Google Scholar 

  30. 30.

    Möglich A, Moffat K. Engineered photoreceptors as novel optogenetic tools. Photochem Photobiol Sci. 2010;9:1286–300.

    Article  Google Scholar 

  31. 31.

    Camsund D, Linblad P, Jaramillo A. Genetically engineered light sensors for control bacterial gene expression. Biotechnol J. 2011;6:826–36.

    CAS  Article  Google Scholar 

  32. 32.

    Wiltbank LB, Kehoe DM. Diverse light responses of cyanobacteria mediated by phytochrome superfamily photoreceptor. Nat Rev Microbiol. 2019;17:37–50.

    CAS  Article  Google Scholar 

Download references

Acknowledgements

The first author (DA) acknowledges the Indonesia Endowment Fund for Education, Ministry of Finance of Indonesia (LPDP RI), and Ministry of Research and Technology of Indonesia for providing BUDI-LN scholarship

Funding

This work was supported financially by the Core Research of Evolutional Science and Technology program (CREST) from the Japan Science and Technology Agency (JST).

Author information

Affiliations

Authors

Contributions

DA carried out the experiments. DA, KI, and KS designed the experiments. DA, KI, and KS performed the data analysis and wrote the manuscript. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Kazunori Ikebukuro or Koji Sode.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors approved the final version of this manuscript.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Figure S1.

Scheme of CCA system with red and green light-regulated gene expression system, derived from Fremyella diplosiphon [14] with some modifications. a Under red light, RcaE, RcaF, and RcaC are phosphorylated. Phosphorylated RcaC binding to L-box within the promoter region activates pcyA and cpc2 transcription and represses cpeC transcription. b Under green light, RcaE, RcaF, and RcaC are dephosphorylated. Unphosphorylated RcaC does not bind to L-box; consequently, pcyA and cpc2 transcription is deactivated and cpeC is transcribed. Figure S2. Experimental scheme of E. coli transformants harboring pBR-RSS-bfp and pBR-GSS-RSS under pseudo-continuous cultivation [25].

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Ariyanti, D., Ikebukuro, K. & Sode, K. Artificial complementary chromatic acclimation gene expression system in Escherichia coli. Microb Cell Fact 20, 128 (2021). https://doi.org/10.1186/s12934-021-01621-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12934-021-01621-3

Keywords

  • Artificial complementary chromatic acclimation
  • Gene expression system
  • CcaS/CcaR
  • Escherichia coli