Skip to main content

Table 2 Key mutations categorized by those which repeatedly mutated (i.e., had multiple unique mutations in any ORF or genetic region) in K-12 MG1655, DH1, or those which were shared across the strains

From: Generation of a platform strain for ionic liquid tolerance using adaptive laboratory evolution

Strain Gene Mutation Mutation type Mutated allele function Strain IL observed Count
Combined mdtJ/tqsA Intergenic (− 56/− 237) Δ120 bp DEL Transporter MG B, E 23
tqsA/mdtJ Intergenic (− 239/− 54) Δ120 bp DEL Transporter DH1 B 5
tqsA Coding (857–868/1035 nt) Δ12 bp DEL Transporter MG B 6
pntA–tqsA Δ3035 bp DEL Transhydrogenase/transporter DH1 B 2
yhdP Coding (2440–2443/3801 nt) Δ2 bp DEL Transporter MG B 1
  Coding (647/3801 nt) (TGGAGCC)1 → 2 INS Transporter MG B 4
  Coding (200–201/3801 nt) IS5 (−) +4 bp MOB Transporter MG B 1
  Coding (3102–3110/3801 nt) IS element(+) +9 bp MOB Transporter DH1 B 1
  Coding (2887–2890/3801 nt) Δ4 bp DEL Transporter DH1 B 1
MG1655 rpoC P359L (CCA → CTA) SNP RNA synthesis MG B 4
  F773Y (TTC → TAC) SNP RNA synthesis MG B 6
  R1075S (CGT → AGT) SNP RNA synthesis MG B 1
cspC Coding (33–41/210 nt) IS1 (−) +9 bp MOB Stress protein MG B 1
  Q37* (CAG → TAG) SNP Stress protein MG E 1
rpsG Coding (460/540 nt) Δ1 bp DEL Subunit of ribosome MG B 1
  L157* (TTA → TGA) SNP Subunit of ribosome MG B 2
rph Pseudogene (667/669 nt) + C INS Nucleotide biosynthesis MG E 2
pyrE/rph Δ82 bp DEL Nucleotide biosynthesis MG B 5
DH1 rho G61E (GGA → GAA) SNP Transcription termination factor DH1 B 2
  Y80H (TAC → CAC) SNP Transcription termination factor DH1 E 5
  Y80C (TAC → TGC) SNP Transcription termination factor DH1 B 2
  T406P (ACC → CCC) SNP Transcription termination factor DH1 E 4
fhuA Coding (337–479/2244 nt) Δ143 bp DEL Transport of ferrichrome DH1 E 1
  Coding (1442/2244 nt) (GTCATAACGACCGCCTAGGG)1 → 2 INS Transport of ferrichrome DH1 E 1
  Coding (2107/2244 nt) Δ1 bp DEL Transport of ferrichrome DH1 B 2
  Coding (2129/2244 nt) Δ1 bp DEL Transport of ferrichrome DH1 E 4
rcdA L55S (TTG → TCG) SNP Transcription regulator DH1 E 1
  Coding (338–341/537 nt) IS element(+) +4 bp MOB Transcription regulator DH1 E 1
purB K404T (AAG → ACG) SNP Nucleotide biosynthesis DH1 B 2
  S21N (AGC → AAC) SNP Nucleotide biosynthesis DH1 E 1
gadE Coding (273–281/528 nt) IS element(-) +9 bp MOB Transcriptional activator DH1 E 2
  Coding (273–281/528 nt) IS element(+) +9 bp MOB Transcriptional activator DH1 E 1
  1. Different unique mutations in the same gene or allele were identified in different clones across the different experiments. The mutations were categorized as ‘combined’, i.e., identified in both strains, or ‘strain-specific’. B and E denotes [C4C1Im]Cl and [C2C1Im][OAc] IL, respectively, where MG denotes K-12 MG1655 strain