From: Generation of a platform strain for ionic liquid tolerance using adaptive laboratory evolution
Strain | Gene | Mutation | Mutation type | Mutated allele function | Strain | IL observed | Count |
---|---|---|---|---|---|---|---|
Combined | mdtJ/tqsA | Intergenic (â 56/â 237) Î120 bp | DEL | Transporter | MG | B, E | 23 |
tqsA/mdtJ | Intergenic (â 239/â 54) Î120 bp | DEL | Transporter | DH1 | B | 5 | |
tqsA | Coding (857â868/1035 nt) Î12 bp | DEL | Transporter | MG | B | 6 | |
pntAâtqsA | Î3035Â bp | DEL | Transhydrogenase/transporter | DH1 | B | 2 | |
yhdP | Coding (2440â2443/3801 nt) Î2 bp | DEL | Transporter | MG | B | 1 | |
 | Coding (647/3801 nt) (TGGAGCC)1 â 2 | INS | Transporter | MG | B | 4 | |
 | Coding (200â201/3801 nt) IS5 (â) +4 bp | MOB | Transporter | MG | B | 1 | |
 | Coding (3102â3110/3801 nt) IS element(+) +9 bp | MOB | Transporter | DH1 | B | 1 | |
 | Coding (2887â2890/3801 nt) Î4 bp | DEL | Transporter | DH1 | B | 1 | |
MG1655 | rpoC | P359L (CCA â CTA) | SNP | RNA synthesis | MG | B | 4 |
 | F773Y (TTC â TAC) | SNP | RNA synthesis | MG | B | 6 | |
 | R1075S (CGT â AGT) | SNP | RNA synthesis | MG | B | 1 | |
cspC | Coding (33â41/210 nt) IS1 (â) +9 bp | MOB | Stress protein | MG | B | 1 | |
 | Q37* (CAG â TAG) | SNP | Stress protein | MG | E | 1 | |
rpsG | Coding (460/540 nt) Î1 bp | DEL | Subunit of ribosome | MG | B | 1 | |
 | L157* (TTA â TGA) | SNP | Subunit of ribosome | MG | B | 2 | |
rph | Pseudogene (667/669 nt) + C | INS | Nucleotide biosynthesis | MG | E | 2 | |
pyrE/rph | Î82Â bp | DEL | Nucleotide biosynthesis | MG | B | 5 | |
DH1 | rho | G61E (GGA â GAA) | SNP | Transcription termination factor | DH1 | B | 2 |
 | Y80H (TAC â CAC) | SNP | Transcription termination factor | DH1 | E | 5 | |
 | Y80C (TAC â TGC) | SNP | Transcription termination factor | DH1 | B | 2 | |
 | T406P (ACC â CCC) | SNP | Transcription termination factor | DH1 | E | 4 | |
fhuA | Coding (337â479/2244 nt) Î143 bp | DEL | Transport of ferrichrome | DH1 | E | 1 | |
 | Coding (1442/2244 nt) (GTCATAACGACCGCCTAGGG)1 â 2 | INS | Transport of ferrichrome | DH1 | E | 1 | |
 | Coding (2107/2244 nt) Î1 bp | DEL | Transport of ferrichrome | DH1 | B | 2 | |
 | Coding (2129/2244 nt) Î1 bp | DEL | Transport of ferrichrome | DH1 | E | 4 | |
rcdA | L55S (TTG â TCG) | SNP | Transcription regulator | DH1 | E | 1 | |
 | Coding (338â341/537 nt) IS element(+) +4 bp | MOB | Transcription regulator | DH1 | E | 1 | |
purB | K404T (AAG â ACG) | SNP | Nucleotide biosynthesis | DH1 | B | 2 | |
 | S21N (AGC â AAC) | SNP | Nucleotide biosynthesis | DH1 | E | 1 | |
gadE | Coding (273â281/528 nt) IS element(-) +9 bp | MOB | Transcriptional activator | DH1 | E | 2 | |
 | Coding (273â281/528 nt) IS element(+) +9 bp | MOB | Transcriptional activator | DH1 | E | 1 |