Generation of a platform strain for ionic liquid tolerance using adaptive laboratory evolution

Mohamed, Elsayed T.; Wang, Shizeng; Lennen, Rebecca M.; Herrgård, Markus J.; Simmons, Blake A.; Singer, Steven W.; Feist, Adam M.

doi:10.1186/s12934-017-0819-1

Microbial Cell Factories

Table 2 Key mutations categorized by those which repeatedly mutated (i.e., had multiple unique mutations in any ORF or genetic region) in K-12 MG1655, DH1, or those which were shared across the strains

From: Generation of a platform strain for ionic liquid tolerance using adaptive laboratory evolution

Strain	Gene	Mutation	Mutation type	Mutated allele function	Strain	IL observed	Count
Combined	mdtJ/tqsA	Intergenic (− 56/− 237) Δ120 bp	DEL	Transporter	MG	B, E	23
	tqsA/mdtJ	Intergenic (− 239/− 54) Δ120 bp	DEL	Transporter	DH1	B	5
	tqsA	Coding (857–868/1035 nt) Δ12 bp	DEL	Transporter	MG	B	6
	pntA–tqsA	Δ3035 bp	DEL	Transhydrogenase/transporter	DH1	B	2
	yhdP	Coding (2440–2443/3801 nt) Δ2 bp	DEL	Transporter	MG	B	1
		Coding (647/3801 nt) (TGGAGCC)1 → 2	INS	Transporter	MG	B	4
		Coding (200–201/3801 nt) IS5 (−) +4 bp	MOB	Transporter	MG	B	1
		Coding (3102–3110/3801 nt) IS element(+) +9 bp	MOB	Transporter	DH1	B	1
		Coding (2887–2890/3801 nt) Δ4 bp	DEL	Transporter	DH1	B	1
MG1655	rpoC	P359L (CCA → CTA)	SNP	RNA synthesis	MG	B	4
		F773Y (TTC → TAC)	SNP	RNA synthesis	MG	B	6
		R1075S (CGT → AGT)	SNP	RNA synthesis	MG	B	1
	cspC	Coding (33–41/210 nt) IS1 (−) +9 bp	MOB	Stress protein	MG	B	1
		Q37* (CAG → TAG)	SNP	Stress protein	MG	E	1
	rpsG	Coding (460/540 nt) Δ1 bp	DEL	Subunit of ribosome	MG	B	1
		L157* (TTA → TGA)	SNP	Subunit of ribosome	MG	B	2
	rph	Pseudogene (667/669 nt) + C	INS	Nucleotide biosynthesis	MG	E	2
	pyrE/rph	Δ82 bp	DEL	Nucleotide biosynthesis	MG	B	5
DH1	rho	G61E (GGA → GAA)	SNP	Transcription termination factor	DH1	B	2
		Y80H (TAC → CAC)	SNP	Transcription termination factor	DH1	E	5
		Y80C (TAC → TGC)	SNP	Transcription termination factor	DH1	B	2
		T406P (ACC → CCC)	SNP	Transcription termination factor	DH1	E	4
	fhuA	Coding (337–479/2244 nt) Δ143 bp	DEL	Transport of ferrichrome	DH1	E	1
		Coding (1442/2244 nt) (GTCATAACGACCGCCTAGGG)1 → 2	INS	Transport of ferrichrome	DH1	E	1
		Coding (2107/2244 nt) Δ1 bp	DEL	Transport of ferrichrome	DH1	B	2
		Coding (2129/2244 nt) Δ1 bp	DEL	Transport of ferrichrome	DH1	E	4
	rcdA	L55S (TTG → TCG)	SNP	Transcription regulator	DH1	E	1
		Coding (338–341/537 nt) IS element(+) +4 bp	MOB	Transcription regulator	DH1	E	1
	purB	K404T (AAG → ACG)	SNP	Nucleotide biosynthesis	DH1	B	2
		S21N (AGC → AAC)	SNP	Nucleotide biosynthesis	DH1	E	1
	gadE	Coding (273–281/528 nt) IS element(-) +9 bp	MOB	Transcriptional activator	DH1	E	2
		Coding (273–281/528 nt) IS element(+) +9 bp	MOB	Transcriptional activator	DH1	E	1

Different unique mutations in the same gene or allele were identified in different clones across the different experiments. The mutations were categorized as ‘combined’, i.e., identified in both strains, or ‘strain-specific’. B and E denotes [C₄C₁Im]Cl and [C₂C₁Im][OAc] IL, respectively, where MG denotes K-12 MG1655 strain

Back to article page

ISSN: 1475-2859

Contact us

Submission enquiries: journalsubmissions@springernature.com