Skip to main content

Table 2 Plasmid, strain or primer

From: Overexpression of membrane-bound gluconate-2-dehydrogenase to enhance the production of 2-keto-d-gluconic acid by Gluconobacter oxydans

plasmid, strain or primer Description or primer sequence Source or added sitea
Plasmid
 pRK2013 KmR, mob+, tra+, helper plasmid Laboratory stored
 pBBR1MCS5 Broad-host-range cloning vector; mod, rep, Gm R , lacZ [21]
 pBBR1MCS5-P tufB -ga2dh pBBRMCS5 derivative expressing gox1230-gox1232 containing a tufB promoter, Gm R This study
 pBBR1MCS5-P ga2dh -ga2dh pBBRMCS5 derivative expressing gox1230-gox1232 containing a ga2dh promoter, Gm R This study
 pBBR1MCS5-P gHp0169 -ga2dh pBBRMCS5 derivative expressing gox1230-gox1232 containing a gHp0169 promoter, Gm R This study
Strain
 E. coli DH5α F-, ϕ80, lacZ∆M15, ∆(lacZYA-argF), U169, endA1, recA1, hsdR17(rk-mK+), supE44, λ, thi-1, gyrA96, relA1, phoA Tiangen, Beijing, China
 G. oxydans Wild type, cefR DSM2003
 G. oxydans_pBBR1MCS5 G. oxydans contain plasmid pBBR1MCS5 This study
 G. oxydans_tufB_ga2dh G. oxydans contain plasmid pBBR1MCS5-P tufB -ga2dh, CefR, GmR This study
 G. oxydans_g2adh_ga2dh G. oxydans contain plasmid pBBR1MCS5-P ga2dh -ga2dh, CefR, GmR This study
 G. oxydans_gHp0169_ga2dh G. oxydans contain plasmid pBBR1MCS5-P gHp0169 -ga2dh, CefR, GmR This study
Primer
 ga2dhf CTATCTAGAGGAGAAACCTGTGCCCCCCATG XbaI
 ga2dhr GAGGGATCCTTCAGTTCAGTGAGACCGCATCATC BamHI
 P tufB _f ACTGAGCTCCGATGGTAAGAAATCCACTGC SacI
 P tufB _r ATATCTAGACCAAAACCCCGCTCCACC XbaI
 P-ga2dh_f CACTCTAGACAGAACCAGTGGCCGCCCCGACAAC XbaI
 P-ga2dh_r GAGCTGCAGTTCAGTTCAGTGAGACCGCATCATC PstI
 P-gHp0169_f ATAGAGCTCTGAAAGCGGCTGGCGCGT SacI
 P-gHp0169_r GCATCTAGAGCGGAAGGCGTTATACCCTGA XbaI
rtPCR primers
 16s-RNA_f GCGGTTGTTACAGTCAGATG  
 16s-RNA_r GCCTCAGCGTCAGTATCG  
 gox1230_f GCTGGAGCGAGGAAGACATC  
 gox1230_r CGGGTGGCAGACTTTTGAG  
 gox1231_f CCAGAACCTGTCCCAGTCCAC  
 gox1231_r CGACAACATTACGGCAAAGG  
 gox1232_f CGACAACATTACGGCAAAGG  
 gox1232_r GCCAGGGAAACCCAGCAT  
 gox0265_f AATGTTCGAGTGGGGTGGTC  
 gox0265_r CCCTTGGCGTCCTTTTCAG  
  1. aRestriction endonuclease sites underlined