Fig. 6

Rolling circle amplification of single-stranded circular M13mp18 by IME199 DNAP. A Schematic diagram of rolling circle amplification. DNA polymerase with strand displacement and processive synthesis capability amplifies primed M13mp18 DNA into a large single-stranded DNA product. B Agarose gel electrophoresis of IME199 DNAP, phi29 DNAP and T4 DNAP amplification primed M13mp18 products. The primed (primer sequence: 5′- TCGTAATCATGGTCATAGCTGTTTCCTG -3′) M13mp18 DNA was incubated at 25 ng with 10 U T4 DNAP, 10 U phi29 DNAP or 100 nM IME199 DNAP at 30 °C for 40 min, and then analyzed by non-denaturing 1% agarose electrophoresis. Lane 1, DNA marker; lane 2, M13mp18 single-stranded DNA; lane 3, M13mp18 double-stranded DNA; lane 4, T4 DNA polymerase; lane 5, phi29 DNA polymerase; lane 6, IME199 DNA polymerase. C Yield of M13mp18 amplified by IME199 DNAP using primers of different lengths. The assay was performed using 25 ng of single-stranded M13mp18 DNA and 100 nM IME199 DNAP. The primer sequences were listed in Additional file 1: Table S2. D Yield of M13mp18 amplified by IME199 DNAP using primers with different G+C content. 25 ng of single-stranded M13mp18 DNA was amplified by 100 nM IME199 DNAP at 30 °C for 1 h in the presence of primers with different G+C content. The primer sequences were listed in Additional file 1: Table S2. Data are shown as the mean ± SD. Statistical analysis was performed by one-way analysis of variance following a Dunnett’s multiple comparisons test. **P < 0.01, ****P < 0.0001