Skip to main content
Fig. 5 | Microbial Cell Factories

Fig. 5

From: Identification of a novel family B DNA polymerase from Enterococcus phage IME199 and its overproduction in Escherichia coli BL21(DE3)

Fig. 5

Study on the activity of IME199 DNAP mutant proteins. A Exonuclease activity test of IME199 DNAP and its mutant proteins (199P-D30A, 199P-E32A, 199P-D112A and 199P-D251A). The 5′-FAM-labeled 24 nt oligonucleotide (5′FAM- TCCTAACGAGATTAGTTTTGCTGT-3′) was incubated at 400 nM with 50 nM IME199 DNAP or its mutant proteins (199P-D30A, 199P-E32A, 199P-D112A and 199P-D251A) at 30 °C for 20 min and then analyzed on a 20% denaturing PAGE gel. B Polymerase activity test of IME199 DNAP and its mutant proteins (199P-D30A, 199P-E32A, 199P-D112A and 199P-D251A). The primed-template (24/50 nt) substrate was incubated at 400 nM with 50 nM IME199 DNAP or its mutant proteins (199P-D30A, 199P-E32A, 199P-D112A and 199P-D251A) and 125 μM dNTPs at 30 °C for 20 min, and then analyzed on a 20% denaturing PAGE gel. C Exonuclease activity test of IME199 DNAP and its mutant proteins (199P-Y333A, 199P-G335A, 199P-S360A, 199P-T575A, 199P-D596A and 199P-Y639A). The 5′-FAM-labeled 24 nt oligonucleotide (5′FAM- TCCTAACGAGATTAGTTTTGCTGT -3′) was incubated at 400 nM with 50 nM IME199 DNAP or its mutant proteins (199P-Y333A, 199P-G335A, 199P-S360A, 199P-T575A, 199P-D596A and 199P-Y639A) at 30 °C for 20 min and then analyzed on a 20% denaturing PAGE gel. (D) Polymerase activity test of IME199 DNAP and its mutant proteins (199P-Y333A, 199P-G335A, 199P-S360A, 199P-T575A, 199P-D596A and 199P-Y639A). The primed-template (24/50 nt) substrate was incubated at 400 nM with 50 nM IME199 DNAP or its mutant proteins (199P-Y333A, 199P-G335A, 199P-S360A, 199P-T575A, 199P-D596A and 199P-Y639A) and 125 μM dNTPs at 30 °C for 20 min, and then analyzed on a 20% denaturing PAGE gel. 199P represents IME199 DNAP in the figure

Back to article page