Skip to main content
Fig. 3 | Microbial Cell Factories

Fig. 3

From: Identification of a novel family B DNA polymerase from Enterococcus phage IME199 and its overproduction in Escherichia coli BL21(DE3)

Fig. 3

Polymerase activity test of IME199 DNAP. A Schematic representation of polymerase activity research. A primed-template (24/50 nt) substrate in which the primer was 5′-FAM–labeled was extended by IME199 DNAP into a complete double strand (50/50 nt) in the presence of dNTPs. B Extension of a primed-template (24/50 nt) substrate by IME199 DNAP. 400 nM substrate was incubated with different concentrations of IME199 DNAP and 125 μM dNTPs at 30 °C for 20 min, and then analyzed on a 20% denaturing PAGE gel. C Effect of dNTPs on IME199 DNAP polymerase activity. A primed-template (24/50 nt) substrate was incubated at 400 nM with 50 nM IME199 DNAP and different concentrations of dNTPs at 30 °C for 20 min, and then analyzed on a 20% denaturing PAGE gel. The primed-template (24/50 nt) substrate was made by hybridizing two oligonucleotide strands (24 nt oligonucleotide sequence: 5′FAM- TCCTAACGAGATTAGTTTTGCTGT -3′, 50 nt oligonucleotide sequence 5′-CCCATACAAATAAACCAAAAAACAATACAGCAAAACTAATCTCGTTAGGA-3′)

Back to article page

Microbial Cell Factories

ISSN: 1475-2859

Contact us