Table 2 Plasmids used in this work
From: Development of an industrial yeast strain for efficient production of 2,3-butanediol
p426-hph | pMB1 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy), hph marker backbone for construction of donor DNA | MCB, KU Leuven |
|---|---|---|
pBEVY-hph | ColE1 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy), hph marker backbone for construction of BDOp | MCB, KU Leuven |
pTEF-Cas9-KanMX (p51) | pBR322 ori (E. coli) and CEN ori (single copy), vector backbone p414-TEF1p-Cas9-CYC1t KanMX marker | MCB, KU Leuven |
pgRNA-uni-hph (p58) | pBR322 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy) gRNA plasmid backbone with hph marker | MCB, KU Leuven |
pgRNA-uni-NAT (p59) | pBR322 ori (E. coli) and 2 micron ori (S. cerevisiae, multi-copy) gRNA plasmid backbone with NAT marker | MCB, KU Leuven |
P58-PDC1 | P58 backbone with 2 gRNA targeting sequence for PDC1 (AGCATCCAACAATTTTTGCA and GATAAGCTTTATGAAGTCAA) | MCB, KU Leuven |
P58-PDC5 | P58 backbone with 2 gRNA targeting sequence for PDC5 (AGCATCCAACAATTTTTGCA and GATAAGCTTTATGAAGTCAA) | MCB, KU Leuven |
P58-PDC6 | P58 backbone with 2 gRNA targeting sequence for PDC6 (CTATCGAAAAGCTGATTCAT and GCTGATTTGATCCTTTCGGT | This study |
P59-mk114 | P59 backbone with 2 gRNA targeting sequence for mk114 site (GTGATTTCGTGTGCAACCAA and TGACAACAAAGAAGCAAATA) | This study |
P59-GPD2 | P59 backbone with 2 gRNA targeting sequence for GPD2 (CACCATCGCCAAAGTCATTG and CTCCGCAGCCATTCAAAGGC) | This study |
P59-GPD1 | P59 backbone with 2 gRNA targeting sequence for GPD1 (CGTATCTGTAGCCAATTGAA and AGTGTCATCGAAGATGTTGC) | This study |
P59-MPC1 | P59 backbone with 2 gRNA targeting sequence for MPC1 gene (AAAGACCCTACACTAATCTC and GAAACTGCGCAATTAGCTCA) | This study |
P59-Ora1 | P59 backbone with 2 gRNA targeting sequence for Ora1 gene (AAGAAGACTGTCCTCATTAC and AGTTAGATACAGAGGTAACG) | This study |
P59-mk20 | P59 backbone with 2 gRNA targeting sequence for mk20 site (TCGAATCCAGAATCAGATAC and GCCGTTCAGTCGAAAGAGTT) | This study |
pBEVY-BDOp-PDC1 | pBEVY backbone with BDOp and homologous regions for integration at PDC1 locus | This study |
pBEVY-BDOp-PDC5 | pBEVY backbone with BDOp and homologous regions for integration at PDC5 locus | This study |
pBEVY-BDOp-PDC6 | pBEVY backbone with BDOp and homologous regions for integration at PDC6 locus | This study |
pBEVY-bdhA-AD7 | pBEVY backbone with expression cassette TEF1p-BdhA-CYC1t and homologous regions for integration at AD7 site | This study |
pBEVY-Nde1-Aox1-mk114 | pBEVY backbone with TDH3p-Nde1-ADH1t, ADH1p-Aox1-ADH2t and homologous regions for integration at mk114 site | This study |
pBEVY-Nde1-GPD2 | pBEVY backbone with Nde and homologous regions for replacement of GPD2 gene | This study |
pBEVY-Nde1-GPD1 | pBEVY backbone with Nde and homologous regions for replacement of GPD1 gene | This study |
pBEVY-CYC1p-GPD1-mk20 | pBEVY backbone with CYC1p-GPD1-GPD1t and homologous regions for integration of mk20 site | This study |
P426-NoxE-mk114 | P426 backbone with TDH3p-NoxE-ADH1t and homologous regions for integration of mk114 site | This study |
pBEVY-CSTL1-mk119 | pBEVY backbone with TEF1p-CSTL1-CYC1t and homologous regions for integration of mk119 site | This study |