The introduction of an N-glycosylation site into prochymosin greatly enhances its production and secretion by Pichia pastoris

Table 1 Primers for the site mutation, qPCR and verified of UGGTs gene knockout

Primer name ^a	Sequence (5′ to 3′)
chy-F	gggtatctctcgagaaaagacaccatcaccatcaccactccggtatcaccagaatcc
chy34-F	cttgcaaagacaacaatacaacgtctcctccaagtactcctccttgggtaaggtcgc
chy34-R	gcgaccttacccaaggaggagtacttggaggagacgttgtattgttgtctttgcaag
chy-R	gtctaaggcgaattaattcgcggccgcttagatggccttggccaaaccgac
qPCR-F	ttgagatccatgccaaccgt
qPCR-R	acgtcacccaagatccacaa
act-F	agtgttcccatcggtcgtag
act-R	ggtgtggtgccagatctttt
UGGT1-F	tggcgggattcgtcaaagat
UGGT1-R	aatgtgagcagcaaaacgcc
UGGT2-F	gccaactggttcaaaacccc
UGGT2-R	tttgactgcgcaactacagc

^aThe primers chy-F, chy34-F, chy34-R, chy-R were used to amplified the gene of chy34. The primer pair qPCR-F and qPCR-R were used to qRT-PCR of prochymosin transcription in both host cells chy-GS115 and chy34-GS115, the act-F and act-R as the primer pair of internal reference gene actin. The primer pair UGGT1-F/UGGT1-R and UGGT1-F/UGGT1-R were used to verify the knockout of UGGT1 and UGGT2, respectively

ISSN: 1475-2859