Skip to main content

Table 1 Endotoxin and exotoxin gene profiles of E. coli KUB-36

From: Anti-cancer and anti-inflammatory effects elicited by short chain fatty acids produced by Escherichia coli isolated from healthy human gut microbiota

Toxin Genes Sequence Products Size (bp) Toxin gene detection
E. coli
KUB-36
Pathogenic E. coli
Endotoxin IpxA 5′GATACGTGATTGATAAATCC3′ 799  +   + 
3′AGTCATTAACGAATCAGACC5′
lpxB 5′CGTTAATGACTGAACAGCGT3′ 1159  +   + 
3′TTCGATCATTGTGCTAACTC5′
lpxC 5′ATACGATGATCAAACAAAGG3′ 928  +   + 
3′TGTCGTTATGCCAGTACAGC5′
lpxD 5′AAGTAATGCCTTCAATTCGA3′ 1036  +   + 
3′GAACGTTAGTCTTGTTGATT5′
waaC 5′GACGGATGCGGGTTTTGATC3′ 970  −   + 
3′TACCTTTATAATGATGATAA5′
waaF 5′TCTGCATGAAAATACTGGTG 1057  +   + 
3′ATCCGTCAGGCTTCCTCTTG5′
waaL 5′AAAACATGCTAACATCCTTT3′ 1270  −   + 
3′TATTCTTAATTAATTGTATT5′
waaQ 5′CGGTGCTAGTATTAACACGT3′ 1043  −   + 
3′ATTTCTACGCTATAGTACCC5′
wzy 5′GTCGCATGAGTCTGCTGCAA3′ 1363  +   + 
3′CATTGTTATCCTTCAACCTG5′
wzz 5′CTTTTCTAATGAAGCGCAAC3′ 988  −   + 
3′ATTACTACTCTCATCTTTTA5′
Enterotoxin etlB 5′GTTGACATATATAACAGAATTCGGGATGAA3′ 604  −   + 
3′AAGCTTGCCCCTCCAGCCTAGCTTAGTTTT5′
Stb 5′TATTATATTTCGAAGCTTAAGTATTGTTGA3′ 1087  −   + 
3′CATGACACGAAGCGCAGGCTGTTGCGCACC5′
  1.  + : present; − : not present