Skip to main content

Table 1 Mutagenic primers used to carry out truncations in the α-MAT secretory signal

From: Differential role of segments of α-mating factor secretion signal in Pichia pastoris towards granulocyte colony-stimulating factor emerging from a wild type or codon optimized copy of the gene

Primers Primer Sequence
Matα:WT GCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAG
Matα:Δ57–70 F.P: 5′-GCTGTTTTGCCATTTTCCGCCAGCATTGCTGCTAAAG-3’
R.P: 5′-CTTTAGCAGCAATGCTGGCGGAAAATGGCAAAACAGC-3’
Matα:WT CTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCG
Matα:Δ30–43 F.P: 5′-CTACAACAGAAGATGAATTAGAAGGGGATTTCG-3’
R.P: 5′-CGAAATCCCCTTCTAATTCATCTTCTGTTGTAG-3’
Matα:WT CGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCC
Matα:Δ47–49 F.P: 5′-CGGTTACTCAGATTTAGAAGGGGTTGCTGTTTTGCCATTTTCC-3’
R.P: 5′-GGAAAATGGCAAAACAGCAACCCCTTCTAAATCTGAGTAACCG-3’
  1. The underlined sequences were removed in the different α-MAT deletion constructs. The corresponding WT α-MAT sequences are shown above the deletion