Skip to main content

Advertisement

Table 2 Oligonucleotides used for real-time RT-PCR

From: Engineering Pseudomonas putida for isoprenoid production by manipulating endogenous and shunt pathways supplying precursors

Name DNA sequence
RpoN-Fw TCGACCCGGAGCTGGATA
RpoN-Rv CGGCTCGAACTGCTGGAT
Pp_katA-818 dir ACCCATTCGACGTGACCAAG
Pp_katA-899 rv GGGTTACGGTTGAGCTCCAG
Pp_ccoN-452 dir AGCGCAACACCAAACACATC
Pp_ccoN-534 rv GTTGACGATGTGCAGCAGTG
Pp_cioA-306 dir ACTGACTGCGTTCTTCCTCG
xPp_cioA-400 rv TCACCGTGGAGAAGAAGTGC