Table 1 Bacterial strains, plasmids and primers used in this study
Strain/plasmid/primer | Description | Source |
|---|---|---|
Strain | ||
 LYS1 | Derivative of E. coli MG1655, capable of producing lysine [17] | Lab stock |
 MU-1 | Lysine hyperproducer obtained by high-throughput screening [17] | Lab stock |
 MU-11 | Derivative of MU-1 by elimination of its plasmid pAG that is non-relevant with lysine production [17] | This study |
Plasmid | ||
 pKAR | Kanamycin resistance, substitution of the exo, bet and gam genes on plasmid pKD46 (GenBank accession no.: MF287367) with a dnaQ mutant KR5-2 [42] | This study |
 pSB4K5-I52002 | Kanamycin resistance, GenBank accession no.: EU496099 | [45] |
 pSB | Kanamycin resistance, backbone pSB4K5, used as a control plasmid without expressing any additional gene | This study |
 pSB-speB | Derivative of pSB, expressing SpeB with native promoter | This study |
 pSB-speBC905T | Derivative of pSB, expressing SpeBA302V with native promoter | This study |
 pSB-atpB | Derivative of pSB, expressing AtpB with native promoter | This study |
 pSB-atpBG494A | Derivative of pSB, expressing AtpBS165N with native promoter | This study |
 pSB-sRNAsecY-MicC | Derivative of pSB, expressing a small regulatory RNA to inhibit SecY synthesis | This study |
Primer | ||
 KR-F | cctgaattcgagctctaaggaggttataaaaaatgagcactgcaattacacgccag |  |
 KR-R | tatcccgggttattatgctcgccagaggcaacttccgcctttc |  |
 B4K5-F | tcaactagtagcggccgctgcaggag |  |
 B4K5-R | cgacggatcctagggaattcgagtcac |  |
 speB-F | gaattccctaggatccgtcgcgctgttaacccagttccgcgat |  |
 speB-R | cagcggccgctactagttgacaatgtttgacgaccatcctgcatc |  |
 atpB-F | gaattccctaggatccgtcgtgatagcaagtggattgctgttc |  |
 atpB-R | cagcggccgctactagttgaatcatcgggatagcatccaccag |  |
 secY-F | gaattccctaggatccgtctttacagctagctcagtcctagggactgtgctagcatctaatcccggttgtttagccattttctgttgggccattgcattg |  |
 secY-R | cagcggccgctactagttgtataaacgcagaaaggcccaccc |  |