Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Construction and characterization of broad-host-range reporter plasmid suitable for on-line analysis of bacterial host responses related to recombinant protein production

Name Sequence (5′ → 3′)
a) PCR primers:
 RfpF_NdeI ATATTCATATGGTTTCCAAGGGCGAGGAGG
 RfpR_NotI TTTATAGCGGCCGCAAAAACAGCCGTTGCCAGAAAG
 014_cfp_F ACCCTCCCTCGGCTTGTGCCGCGGCCGCAAAAGGAAAAGA
 014_cfp_RBS2_R GGAATATAGCAAATAAGGAGGAGGAAAATGAGCAAGGGCGAGGAGCTG
 014_pib_F AGCTTTTGTTCGGATCCAGCAAACTGCAAAAAAAAGTCCGCTGA
 014_pib_RBS2_R TTTCCTCCTCCTTATTTGCTATATTCCACCTGAATGGGTTGCGAATCGCGTTTAG
 YfpF_NdeI CGTGCATATGAGCAAAGGTGAAGAAC
 YfpR_NotI TGCTAGCGGCCGCAGGACAGCTATTGTAGATAAG
 032_002_F CCCGGTTTGATAGGGATAAG
 032_002_R TACGGATGAGCATTCATCAG
 032_014_F CTGATGAATGCTCATCCGTAGATCCAGCAAACTGCAAAAAAAAG
 032_014_R CAATAGCTGTCCTGCGGCCGATCGAGTTGCTGGAGATTGTG
 032_017_F CGGCCGCAGGACAGCTATTGTA
 032_017_R CTTATCCCTATCAAACCGGGATACCCTCCCTCGGCTTGTG
 rpsJ_yfpF_SnaBI GAATGCTCATCCGTAATTACCGCGAAACGGATACCCTCCCTC
 rpsJ_yfpR_NheI CTTATCCCTATCAAACCGGGGGCCTTTAGGTCTTCTTCTG
 pibfxs_cfpF_SnaBI CTTATCCCTATCAAACCGGGATCGAGTTGCTGGAGATTGT
 pibfxs_cfpR_NheI GAATGCTCATCCGTAATTACGGCCTTTAGGTCTTCTTCTG
 021_rpsJ_F AGCTTGACCTGTGAAGTGAA
 021_rpsJ_R CTGAGATCAGCTTTTGTTCG
 021_ibpfxs_F CGAACAAAAGCTGATCTCAGAGGCCTTTAGGTCTTCTTCT
 021_ibpfxs_R TTCACTTCACAGGTCAAGCTAAGGAAAAGATCCGGCAAAC
b) qPCR primers:
 cysG_F1 GTATTCCACTCACGCATCGC
 cysG_R1 CGCCACCGGTTTTTAAGTGT
 rplC_F2 TGACCGATAGAACCCGGAAC
 rplC_R2 CTGGAACTTCCGTACCCAGG