Skip to main content

Table 2 List of primer oligonucleotide sequences used in this study

From: Development of a secretory expression system with high compatibility between expression elements and an optimized host for endoxylanase production in Corynebacterium glutamicum

Primer Sequence
cspB2F cccactaccgagatatccttgaataataattgcaccgcacaggtgatacatg
cspB2R acagccaagctgaattcttagaacttaacgataccggagaggaatgg
cspR agtggtttcctgagcgaatgctg
xynAF tcgctcaggaaaccactgccgagagcacgctcggcgc
xynAR acagccaagctgaattctcagtggtggtggtggtggtgggtgcgggtccagcgttggttg
PS1 ctatgacatgattacgaattctttatacgtttggttatttgccgactg
PS2 gactctagaggatccccggtggaaccgtcagcgtcgt
PS3 ggggatcctctagagtccgctcagaaggcaatcgctgagg
PS4 acgacggccagtgccaagcttattcggccacgaaggcgccg
A6XF tccaccggggatcctctagaagatcttcgagctcaagaaggaac
A6XR gattgccttctgagcggactcagtggtggtggtggtggtgggtgcgggtccagcgttggttg