Skip to main content

Table 3 Primers used in this work

From: Asp305Gly mutation improved the activity and stability of the styrene monooxygenase for efficient epoxide production in Pseudomonas putida KT2440

Primers Sequences 5′–3′
N46S F TGGTCTGCGTTTACTGAGCACAGTTGCCCACAATG
V48G F GCGTTTACTGAATACAGGTGCCCACAATGCCGTGA
V48Q F GCGTTTACTGAATACACAGGCCCACAATGCCGTGA
M186L F GATTCGCGCAGTGACACTGAGCTTCAGCCCGGGTC
M186G F GATTCGCGCAGTGACAGGTAGCTTCAGCCCGGGTC
L269G F CAGTTCTTTAGACATCGGTCAAGGTGGCGTTGTGC
L269V F CAGTTCTTTAGACATCGTTCAAGGTGGCGTTGTGC
D305A F CGTTGATCCGGTTCTGGCCCAAGGTGCCAATATGG
D305X F CGTTGATCCGGTTCTGNNNCAAGGTGCCAATATGG
R GCCTTACTGGTTAGCAGAATG
  1. The bold type shows the site of the variations. Saturated mutation sites were substituted by bold and italic NNN (N = A/G/C/T). In addition, all the site of variations share the same downstream primer