Skip to main content

Table 3 Bacterial strains, plasmids and primers used in this study

From: Enhanced phenolic compounds tolerance response of Clostridium beijerinckii NCIMB 8052 by inactivation of Cbei_3304

Strain/plasmid/primer Relevant characteristics Reference
Strains
 NCIMB 8052 Wild-type NCIMB
 3304::int Group II intron inserted at 101/102a of Cbei_3304 This study
 3304::cp 3304::int harboring 3304-expression vector This study
 3304::int-pWD1 3304::int harboring control vector pWD1 This study
 E. coli DH5α Cloning Invitrogen
 E. coli Top10 Harboring pAN2 plasmid Invitrogen
Plasmids
 pAN2 Methylation plasmid, Φ3T I, p15A ori, TetR [20]
 pWJ1 Derived from pSY6 with pCB102 ORI instead of pIM13 ORI [21]
 pWJ1-3304 Derived from pWJ1 for intron insertion in Cbei_3304 at 101/102a This study
 pWD1-3304 Derived from pWJ1, with Cbei_3304 expressing cassette added This study
Primers Sequence (5′→3′)  
 pWJ1-101-F GGAGTGTCGAGGATCCTCGAGATTATCCTTATAATTCAAAGC This study
 pWJ1-101-R GGTTCTCCTACAGATTGTACAAGTCAAAGCACATAACTTAC This study
 pWD1-101-F GGAGTGTCGAGGATCCTCGAGATGACAAAGGTTAATAAATT This study
 pWD1-101-R CAGATTGTACTGAGAGTGCACCATATGTAATCAACATTGATGGAAT This study
 3304-Test-F ATGCGGATCCATGACAAAGGTTAATAAATT This study
 3304-Test-R GTACGAATTCTTAATCAACATTGATGGAAT This study