Skip to main content

Advertisement

Table 2 Oligonucleotide primers used in this study

From: Development of a counterselectable seamless mutagenesis system in lactic acid bacteria

Primer Sequence (5′–3′)a Restriction site
aldB-uF AGGGTACCGGCGAAAGTCATGTAACAATCC KpnI
aldB-uR CTGACATGATATTTCTCTTTTCTAT  
aldB-dR CCGCTCGAGTGCTGACAGATGGCTGGCTGTG XhoI
aldB-dF GAAAAGAGAAATATCATGTCAGTAATTGCTTAAATTTCTTTAGC  
aldB-testF ATATTTCTGCCACAATTTTCATGCC  
aldB-testR CCAATCCTGTACCAATAACAGCAAT  
pheSF ATAAAAAATCGAAAAGGAGATAAAAATGAACTTACAAGAAAAAATTGAAG  
pheSR AAAGATCTTCAGTCGAATTGTTCTAAGAATC BglII
pheSR2 AAGAATTCTCAGTCGAATTGTTCTAAGAATC EcoRI
siteR ACCAAAACCAGAATAAACAGAAG  
siteF CTGTTTATTCTGGTTTTGGTTTTGGACTCGGTCAAGAACG  
ldhF1 CCGAATTCATTCATTTTACACATTGTA EcoRI
ldhF2 GACAGATCTATTCATTTTACACATTGTA BglII
ldhF3 AGACGTCGACATTCATTTTACACATTGTA SalI
ldhR1 TTTTATCTCCTTTTCGATTTTTTAT  
ldhR2 CGGGATCCTTTTATCTCCTTTTCGATTTTTTAT BamHI
ldhR3 CCGCTCGAGTTTTATCTCCTTTTCGATTTTTTAT XhoI
upF AGGGTACCATGTCAATAGTTGTCGAAAA KpnI
upR CAGTTTCTGCTAAGGTATCA  
downF TGATACCTTAGCAGAAACTGATGAATTAGCACAGCAAGTG  
downR CCGCTCGAGCTCTAGTAAAATGTTCCTCA XhoI
testF TTAAGGAAATGAATTTAGAGGAGAG  
testR AAACCTTCATGTCCTTCTTGAGT  
BL-pheSF AAAGATCTATGGATCTTCAAACCAAACTTG BglII
BL-siteR ACCAAAACCGCCGTAAACGTC  
BL-siteF GACGTTTACGGCGGTTTTGGTTTTGGCCTTGGTCCTGATCG  
BL-pheSR GATCTGCAGTTAACCCTCCTGGCTGAATTGC PstI
gfpF ATAAAAAATCGAAAAGGAGATAAAAAGATATGAGCAAAGGAG  
gfpR CGCGAATTCTTAGTAGAGCTCATC EcoRI
  1. aThe restriction sites in the primer sequences are underlined