Skip to main content

Table 3 Primers and amplification product sizes for each gene in quantitative real-time RT-qPCR analysis

From: Effects of Rho1, a small GTPase on the production of recombinant glycoproteins in Saccharomyces cerevisiae

Gene Forward primer Reverse primer Product length(bp)
RHO1 GAATGTTCGGCCAAGACTG CTTCTTAGCTTTACCATTCGTT 102
FKS2 GGTGGTCGTATCAAGCAT CCATACCAGCACCGATCTTA 103