Primer | Sequence | Description |
---|---|---|
P1 | ATGCCTTTTACCCCGCTCCG | For gaaC amplification from A. niger genome, for colony PCR and sequencing (forward) |
P2 | CTAAGCAATATCCGGCAACG | For gaaC amplification from A. niger genome, for colony PCR and sequencing (reverse) |
P3 | CGGGGGATCCACTAGTTCTAGAGCGGCCGCGTGAGGGTCAGTTATTTCAT | For fragment 1 (−1000 bp HIS3 locus) amplification from S. cerevisiae (forward) |
P4 | TATTTCTTTCTACAAAAGCCCTCCTACCCATCTTTGCCTTCGTTTATCTTG | For fragment 1 (−1000 bp HIS3 locus) amplification from S. cerevisiae (reverse) |
P5 | TAACTCGAAAATTCTGCGTTCGTTAAAGCTAGCTGCAGCATACGATATAT | For fragment 4 (+1000 bp HIS3 locus) amplification from S. cerevisiae (forward) |
P6 | AAGCTGGAGCTCCACCGCGGTGGCGGCCGCGGAGCCATAATGACAGCAGT | For fragment 4 (+1000 bp HIS3 locus) amplification from S. cerevisiae (reverse) |
P7 | AATGAGCAGGCAAGATAAACGAAGGCAAAGATGGGTAGGAGGGCTTTTGT | For fragment 2 (his5) amplification from S. pombae (forward) |
P8 | TTCAGTTTTGGATAGATCAGTTAGAAAGCTATTAAGGGTTCTCGAGAGCT | For fragment 2 (his5) amplification from S. pombae (forward) |
P9 | GGAAGATATGATCTACGTATGGTCATTTCTTC | For TPI1/gaaD amplification from B5470 (forward) |
P10 | GGAGATCTCGAATTGGAGCTAGAGAAAG | For TPI1/gaaD amplification from B5470 (reverse) |
P11 | GATCTACGTATGGTCATTTCTTC | For colony PCR and sequencing gaaD ORF (forward) |
P12 | TCGAATTGGAGCTAGACAAAG | For colony PCR and sequencing gaaD ORF (reverse) |
P13 | ATGGCTCCCCCAGCTGTGTT | For colony PCR and sequencing gaaA ORF (forward) |
P14 | CTACTTCAGCTCCCACTTTC | For colony PCR and sequencing gaaA ORF (reverse) |
P15 | CCTCGCACCCATGTACATTGG | For colony PCR and sequencing gat1 ORF (forward) |
P16 | TTATATTGGCCTTTATGTCCGC | For colony PCR and sequencing gat1 ORF (reverse) |
P17 | TATATACCCGGGGTGCCACCTGACGTCTAAGA | For amplification of TPI1/gat1-gfp from B6367 (forward) |
P18 | TATATACCCGGGAGACCGAGATAGGGTTGAGT | For amplification of TPI1/gat1-gfp from B6367 (reverse) |