Skip to main content

Advertisement

Table 2 Primers used in the present study (restriction sites are underlined)

From: MAL62 overexpression and NTH1 deletion enhance the freezing tolerance and fermentation capacity of the baker’s yeast in lean dough

Primer name Sequence 5′-3′
Kan-U CGGGGTACCCAGCTGAAGCTTCGTACGC
Kan-D CGCGGATCCGCATAGGCCACTAGTGGATCTG
MAL62-U CCGCTCGAGATGACTATTTCTGATCATCC
MAL62-D CCGCTCGAGTTATTTGACGAGGTAGATT
PGK-U CGCGGATCCAAGCTTTCTAACTGATCTATCCAAAACTGA
PGK-D CGCGGATCCAAGCTTTAACGAACGCAGAATTTTC
N-S ATCATCATCTGTAATCGCTTCACC
K-S CCTTTTATATTTCTCTACAGGGGCG
N-X TACAGCGGTAAAGTTTCTATGAGCA
K-X TAGGTTGTATTGATGTTGGACGAGT