Skip to main content

Advertisement

Table 4 Primers used in this study

From: Identification of novel tylosin analogues generated by a wblA disruption mutant of Streptomyces ansochromogenes

Primers Sequence (5′-3′)
Primers for gene disruption and complementation
 LwblA-F AAGCTTTCGGGTACGCCATCTCGTA
 LwblA-R TCTAGAGCTGCTCCCTGAACGAACA
 RwblA-F GGATCCACGACGAGGTGTACGAGAAC
 RwblA-R GATATCTGACGCTGCTGGAGGAGAT
 Kan-F TCTAGAGATCCCCTGGATACCGCTCG
 Kan-R GGATCCGTACCCGAACCCCAGAGTC
 wblAJ-F AACTGGCGGCGGTGAATA
 wblAJ-R ACGGACGGAGCACATATAGG
 CwblA-F GGATCCGCCTGAACGGACGGAGCACATA
 CwblA-R TCTAGAAGCACACTGACACCGAGGAACTTGGC
Primers for qRT-PCR
 RTsanG-F GGCGTACACAGCTCAAGAGC
 RTsanG-R AATTCGTCGATGAGCTGATC
 RTsanN-F AGATCATGCGCTCGGACTGT
 RTsanN-R TGGCGTGCAGGATCGGTA
 RTsanO-F ACTGCGATCCGTGGTCAA
 RTsanO-R TGTACTCCAGGCACTCCC
 RTsanF-F CGGCGCTGGAGGAACGTAC
 RTsanF-R GGGTGTAGAGGCCGATGCT
 RThrdB-F GCTGGCCAAGGAACTCGACAT
 RThrdB-R CGAAGCGCATGGAGACGACG