Skip to main content

Table 3 Primers used in this study

From: A Streptomyces coelicolor host for the heterologous expression of Type III polyketide synthase genes

Primer Sequence 5′–3′ Description
pIJ86F1 ACGCCTGGTCGATGTCGGAC Sequencing primers for recombinant plasmids of pIJ86 and pIJ12477
pIJ86R2 TGCGGTCAGTGCGTGTGTCG
SCO1206F1 ATCCCCAAGACCGAGGACTG Sequencing primer for internal sequence of sco1206-1207-1208
SCO1206F2 AGGCCGTCATGGACCGCCAG
SCO1206F3 TGTTCCACCTGCTGCTGAGC
SCO1206F4 AGTGGTGAGCGGCCTGGTC
SCO1206FBglII AAAAAAGATCTCGCAAGCCTTCCGCGAGGCG PCR of sco1206-1207-1208 for cloning into pIJ12477
SCO1208RHindIII AAAAAAAGCTTCTAACCGTGTCGCAGCGGCGTGAG
SCO1206FSpe CGCAAGCCTTCCGCGAGGCGAAAGCAGGCACGGTTCATGACTAGTATTCCGGGGATCCGTCGACC Flanking primers for sco1206-1207-1208 disruption cassette
SCO1208RNhe GATCGCGCGGACGCTGGCCGGGATGCCGATCCGCTAACCGCTAGCTGTAGGCTGGAGCTGCTTC
SCO1206TF TCGAGCTGGCCAAGCTG Test primers for verification of AprR cassette replacements and in-frame deleted regions
SCO1208TR TGGAGTACGCGCAGACC
SCO7221TF AGTTGCATGGGTCACTGC
SCO7221TR ATGTACCGGCCCAGAGC
SCO7671TF GTTGCACCAGCCGATGG
SCO7669TR GTGAGTCGATGACTGTCGTGG
SCO7221F1 AGTCGGTGCTCCGGCTGGAC Sequencing primer for internal sequence of sco7221
SCO7221FBamHI AAAAAGGATCCCCTCACCTGCTCCGCAGCAGACCC PCR of sco7221 for cloning into pIJ86 and pIJ12477
SCO7221RHindIII AAAAAAAGCTTCTACAGCCACTCCCCTTCCAGAGCGGTGG
SCO7221FSpe CGCCGTGATACACGGCGAGCACTCCGTCGAGACCCGAGAACTAGTATTCCGGGGATCCGTCGACC Flanking primers for sco7221 disruption cassette
SCO7221RNhe GTGGCGGTCAGGCCCGGGGCCGCCGCGTACAGGACGGCAGCTAGCTGTAGGCTGGAGCTGCTTC
SCO7671FSpe GTACGCACGGTAGTGGGGCCGGCGGCCGAGGAAGGCATGACTAGTATTCCGGGGATCCGTCGACC Flanking primers for sco7669-7670-7671 disruption cassette
SCO7669RNhe GTCCGCTACGCGCGCGCCGCGCGGGGCCGGAACGGCTCAGCTAGCTGTAGGCTGGAGCTGCTTC
SVEN5367F1 GGCCCGACACCGAGGACTG Sequencing primer for internal sequence of sven5367
SVEN5367FBamHI AAAAAGGATCCCGGGTGAGTGTGGGCGGCAGTTC PCR of sven5367 for cloning into pIJ12477
SVEN5367RHindIII AAAAAAAGCTTTCAGGCGACGGACGTGCGGG
  1. Bolds indicate restriction sites