Skip to main content

Table 1 Primers

From: Dynamic regulation of gene expression using sucrose responsive promoters and RNA interference in Saccharomyces cerevisiae

Primer name 5′ to 3′ sequence
MAL12F TATTATctcgagACCAACCCGAAAATTCTTC
MAL12R TATTATgaattcTTATGTAATTTAGTTACGCTTGAC
GPH1F TATTATGatcgatTAGTTATCCGACTAGCAAG
GPH1R TATTATgaattcTGTTCAAAATTAAATTAAGTTG
GLC3F TATTATctcgagCGGTGATTTACAAGAAGAGG
GLC3R TATTATatcgatTTTATTCTTGACGGTTCTTTATAC
SUC2F TATTATctcgagACATACTAAGACATTTACCG
SUC2R TATTATgaattcCATATACGTTAGTGAAAAGAAAAG
XhoI-pTEF1F TATTATctcgagGCACACACCATAG
EcoRI-pTEF1R TATTATgaattcTTGTAATTAAAACTTAGATTAGATTG
GFP1F TATTATgaattcCTATATTACTTGGGTATTGCCC
GFP1R TATTATcccgggTCTAAAGGTGAAGAATTATTCAC
LEU2A2 ATAGAATTGTGTAGAATTGCAG
LEU2D2 ATGAAATGAACATTGATTTACTATC
CYC1tF TATAATtctagaACAGGCCCCTTTTCCTTTGT
CYC1tR TATTATgagctcACGATGAGAGTGTAAACTGC
ApaI-SUC2F TATTATgggcccACATACTAAGACATTTACCG
ClaI-SUC2R TATTATatcgatCATATACGTTAGTGAAAAGAAAAG
  1. Restriction enzyme sites are shown in lower case.