Skip to main content

Advertisement

Table 2 Primers used in the bioengineering of bacteria to produce higher alcohols

From: Engineering Corynebacterium crenatum to produce higher alcohols for biofuel using hydrolysates of duckweed (Landoltia punctata) as feedstock

Number Primers name Primer 5′-3′
A1 LEU2-S ACATGCATGCGGATGTCTGCCCCTAAGAAGAT
  LEU2-AS ACGCGTCGACTTAAGCAAGGATTTTCTTAACTTC
A2 ILV2-S ACGCGTCGACAAGGAGCCAGATGATCAGACAATCTACGCT
  ILV2-AS CGCGGATCCTCAGTGCTTACCGCCTGTAC
A3 ILV5-S CGCGGATCCAAGGAGGCCTCATGTTGAGAACTCAAGCCGC
  ILV5-AS GCGAGCTCTTATTGGTTTTCTGGTCTCAACTT
B1 ILV2-S AAAACTGCAGATGATCAGACAATCTACGCT
  ILV2-AS ACGCGTCGACTCAGTGCTTACCGCCTGTAC
B2 ILV5-S ACAGGTCGACAAGGAGGTCATGTTGAGAACTCAAGCCGC
  ILV5-AS CGCGGATCCTTATTGGTTTTCTGGTCTCAA
B3 ILV3-S CGCGGATCCAAGGAGCTGCATGGGCTTGTTAACGAAAGT
  ILV3-AS GCGAGCTCTCAAGCATCTAAAACACAACC
C1 BAT2-S CGGCCTGCAGGATGACCTTGGCACCCCTAGA
  BAT2-AS CGCGGATCCTCAGTTCAAATCAGTAACAA
D2 LEU1-S TCCCCCCGGGAAGGAGACTAATGGTTTACACTCCATCCAA
  LEU1-AS GCGAGCTCCTACCAATCCTGGTGGACTTT
C2 leu1-2as CGCGGATCCAAAGGAGGCCGCATGGTTTACACTCCATCCAAGG
  leu1-2s TCCCCCCGGGCTACCAATCCTGGTGGACTTT
C3 leu2-2s TCCCCCCGGGAAAGGAGGCCGCATGTCTGCCCCTAAGAAGATC
  leu2-2as GCGAGCTCTTAAGCAAGGATTTTCTTAAC
D1 leu4-2as CGGCCTGCAGGATGGTTAAAGAGAGTATTAT
  leu4-2s TCCCCCCGGGTTATGCAGAGCCAGATGCCG
D2 LEU1-S TCCCCCCGGGAAGGAGACTAATGGTTTACACTCCATCCAA
  LEU1-AS GCGAGCTCCTACCAATCCTGGTGGACTTT
F1 leu1-2 s CGGCCTGCAGGATGGTTTACACTCCATCCAA
  leu1-2as CGCGGATCCCTACCAATCCTGGTGGACTT
G1 pBL1-as TCCCCGCGGATTCGGGGTCGTTCACTGGT
  pBL1-s CCATCGATAACAACAAGACCCATCATAG
K1 Kivd-s AAAACTGCAGATGTATACAGTAGGAGATTACCT
  Kivd-as GCTCTAGATTATGATTTATTTTGTTCAGC
H1 ADH2-s GCTCTAGAAGGAAACTCAATGTCTATTCCAGAAACTCAA
  ADH2-as CGGGGTACCTTATTTAGAAGTGTCAACAACG
  1. s = sense and as = antisense.