Skip to main content

Table 1 Primer pairs used in PCR in this study

From: Deletion of the gene encoding the reductase component of 3-ketosteroid 9α-hydroxylase in Rhodococcus equi USA-18 disrupts sterol catabolism, leading to the accumulation of 3-oxo-23,24-bisnorchola-1,4-dien-22-oic acid and 1,4-androstadiene-3,17-dione

Primer Nucleotide sequence (5′→3′) Product size (bp)
#1: Asi9H1-S CGNTAYGCNCGNGGNTGG 728
#2: Asi9H2-A NACIGGRTARTGRCARTT
#3: Asi9H3-S TGYCCNTTYCAYGAYTGG 532
#2: Asi9H2-A NACIGGRTARTGRCARTT
#4: Asi9H7-S GGNAGYGGIATHACNCC 530
#5: Asi9H5-A CCYTCYCKRCAIGARTANGG
#6: UpKshB-F GGTAAGCTTACCGGTCGGCGAGCTCCTTGAACTCGTC 5212
#7: DnKshB-R TCCGAATTCGGATCGACGCCCTCGGGCGGGACAC
#8: Inv-F TGTCGGTACCCACTCGGCACCCGGTCCCAGGAAGG 6669
#9: Inv-R AGAATCTAGATTCTCGAGCGCGCGCACGAATCCTC
#10: Kan-F ATCTTCTAGAAGCTAGCTTCACGCTGCCGCA 1159
#11: Kan-R ATTGAGGTACCCTCAGAAGAACTCGTCAAGAAGG
#10: Kan-F ATCTTCTAGAAGCTAGCTTCACGCTGCCGCA 2786
#12: Down-R TCTCGTGAAGGAATTCGCGAACG
#13: KshB-F GAGCGGATCCGCTCCCGATCAGCGGGAGCCGGAA 2812
#12: Down-R TCTCGTGAAGGAATTCGCGAACG
#13: KshB-F GAGCGGATCCGCTCCCGATCAGCGGGAGCCGGAA 1182
#14: KshB-R CTGAAAGCTTTCAGAACTCGATCTTGAGGTGATCGGT