Skip to main content

Table 4 Primers used in the present study (restriction sites are italics)

From: Effects of MIG1, TUP1 and SSN6 deletion on maltose metabolism and leavening ability of baker’s yeast in lean dough

Primers Sequence (5’ → 3’)
For plasmid construction  
TA-U CCGGAATTC AAATGAAATAATACGGGAAGAGCG
TA-D CGGGGTACC CGGTAGCGATAATGTAAGAGGGTT
TB-U ACGCGTCGAC GAACAGAACACAAAAGGAACAC
TB-D ACATGCATGC GAACCGCAATATTCAGAAACAC
SA-U CCGGAATTC CTTATAACGTGGGCCATGTCAT
SA-D CGCGGATCC CTAGTGACGTTGTCGTATTTGG
SB-U CGCGGATCC TCAACGAGAAATGTTGTGTAGC
SB-D CCCAAGCTT ACATATGCTCATCGGGAAAACC
Kan-U CGCGGATCC CAGCTGAAGCTTCGTACGC
Kan-D CGCGGATCC GCATAGGCCACTAGTGGATCTG
For PCR verification  
YT-U TCTTGTCTGTCTGCTTCTTCACTGT
YT-D AAAGAGTGTGAAGTGACGGCTATG
YS-U CACACTCCGTTCTTAGTGGTTGTT
YS-D ATCCACCGTAGAACCCAAAGCATT
K-U CTTGCTAGGATACAGTTCTCACATCA
K-D CGCATCAACCAAACCGTTATTCATTC
Z-U CCCACACACCATAGCTTCA
Z-D AGCTTGCAAATTAAAGCCTT