Skip to main content

Table 1 Primers used in this study.

From: Reduced evolvability of Escherichia coli MDS42, an IS-less cellular chassis for molecular and synthetic biology applications

name sequence (5'-3') purpose
ORFstart cgggatccatgctattgctgctatttc cloning ORF238
ORFstop cggaattctcataacaaattcaaaatcttcag cloning ORF238
CTXVP2 cctcctggaactggttga amplifying/sequencing ctxvp60
CTXVP3 ggaggatctacttctgct amplifying/sequencing ctxvp60
CVek3 gcctggttgtacgcctgaa amplifying/sequencing ctxvp60
T7 taatacgactcactataggg amplifying/sequencing ctxvp60
chi3 gtgagtttcaccagttttga amplifying/sequencing ctxvp60
vpf1 cctgggtcctattccatcagtagtagttaat constructing ctxvp60 frame-shift
vpf2 tgatggaataggacccaggagttgttgct constructing ctxvp60 frame-shift
IS1-1 tcgctgtcgttctca IS1-specific PCR
IS1-2 aagccactggagcac IS1-specific PCR
IS2-1 tcgcaggcataccatcaa IS2-specific PCR
IS2-2 cagacgggttaacggca IS2-specific PCR
IS3-1 agcggctggtatacgtggt IS3-specific PCR
IS3-2 tcatgcgtggcgacattga IS3-specific PCR
IS5-1 gacagttcggcttcgtga IS5-specific PCR
IS5-2 gctcgatgacttccacca IS5-specific PCR
groL1 atggcgtgggtgaagaag amplification of control groL
groL2 caatctgctgacggatctga amplification of control groL