Table 1 Strains, plasmids and primers used in this study.
Name | Description | Reference/source |
|---|---|---|
Strains | ||
B. megaterium | ||
WH320 | Mutant of DSM319,lacZ- | [4] |
WH323 | Mutant of WH320,xylA1-spoVG-lacZ | [22] |
MS941 | Mutant of DSM319, ΔnprM | [5] |
YYBm1 | Mutant of MS941, ΔxylA, ΔnprM | This study |
E. coli | ||
DH10B | Strain for plasmid construction | Gibco Life Technologies |
Plasmids | ||
pMM1520 | Shuttle vector for cloning in E. coli (Apr) and gene expression under xylose control in B. megaterium (Tcr); P xylA -MCS | [1] |
pMM1522 | pMM1520 derivative – vector for intracellular protein production | [6] |
pMM1525 | pMM1522 derivative – vector for protein secretion into the medium; P xylA -SP lipA -MCS | [6] |
pRBBm23 | sp pga -pga (2,476 bp) (B. megaterium strain ATCC14945) cloned into Bsr GI/Sac I of pMM1522; P xylA -SP pga -pga | This study |
pRBBm48 | pga (2,407 bp) (B. megaterium strain ATCC14945) without coding sequence for sp pga cloned into Bgl II/Eag I of pMM1525; P xylA -SP lipA -pga with Sfo I-spacer | This study |
pRBBm49 | pRBBm48 without Sfo I-spacer; P xylA -SP lipA -pga | This work |
pHBIntE | Shuttle vector for cloning in E. coli (Apr) and gene expression in B. megaterium (Eryr); temperature sensitive B. megaterium ori | [23] |
pHV33 | Aprin E. coli, Cmrin B. subtilis, Cmrin E. coli, Tcrin E. coli | [24] |
pYYBm4 | pHBIntE derivative with xyl A from B. megaterium DSM319 genome sequence | This study |
pYYBm8 | pYYBm4 derivative – xyl A'-cml-'xyl A | This study |
Primers | ||
xylA_as | ttcatgagctcttaagtgttgttcttgtgtcattcc | |
xylA_s | gcaacgagctcagcagtgtatttacttgagagg | |
cml_as | tgattcatatggtcgacaaaaagaaggatatggatctggagc | |
cml_s | acacctctagagtcgacacaaacgaaaattggataaagtggg | |
pga_23_for | tacatatgtaca atgaagacgaagtggctaatatca | |
pga_23_rev | tatcagagctc atcaatagtataggctctttatgc | |
pga_49_for | ttattagatct tggcgcc ggggaggataagaatgaagg | |
pac_49_rev | tatcacggcca gcataaagagcctatactattgat | |
cml_for | ggttatactaaaagtcgtttgttgg | |
cml_rev | cgggtgataaactcaaatacagc | |
xylB_rev | cctattgattcctgctaattgg | |
xylR_for | cggtgcaaatctttgatattcc | |
xylR_for' | cgttaagatagtcgactcc | |
xylB_rev' | ccacaataacttaggaaga | |
putative4_for | ccattatatattctggggcg | |
ery_s | cgtcaattcctgcatgttttaagg | |
ery_antis | ccaaatcggctcaggaaaag |