Skip to main content

Table 2 Plasmids and oligonucleotides used

From: Production of recombinant protein by a novel oxygen-induced system in Escherichia coli

Plasmid, or primer Genotype or sequence Reference or source
Plasmid   
pAB49 Same as pGFPmut3.1 plus Δplac plus psoxS This study
pAB43 Same as pGFPmut3.1 plus Δplac This study
pAB828 Same as pGFPmut3.1 plus ::lacZ-GFPmut3.1 fusion This study
Primers   
GFPmut-A ATGACCATGATTACGCCAAGCTAGTAGGCCTGATAGTAGACTCTAGAGGATCCCCGGGTA  
GFPmut-B TACCCGGGGATCCTCTAGAGTCTACTATCAGGCCTACTAGCTTGGCGTAATCATGGTCAT  
soxS-GFP-A TTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGTAAATCGCTTTACCTCAAGTTAACTTGAGGAATTATACTCCCCAACAGATGAATTAACGAACTGAACACTGAAAAGAGGCAGATTTATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTG  
soxS-GFP-B CACCCTCTCCACTGACAGAAAATTTGTGCCCATTAACATCACCATCTAATTCAACAAGAATTGGGACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCATAAATCTGCCTCTTTTCAGTGTTCAGTTCGTTAATTCATCTGTTGGGGAGTATAATTCCTCAAGTTAACTTGAGGTAAAGCGATTTACTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAA