Skip to main content

Advertisement

Table 2 Primers used in this study

From: Microbial production of sabinene—a new terpene-based precursor of advanced biofuel

Name Sequence (5′ → 3′)
IspA-F GGGAATTCCATATGATGGACTTTCCGCAGCAACTC
IspA-R GGAAGATCTTTATTTATTACGCTGGATGATGT
mvaE-F CATGCCATGGAGGAGGTAAAAAAACATGAAAACAGTAGTTATTATTGATGC
mvaE-R CGCGGATCCTTATTGTTTTCTTAAATCATTTAAAATAGCGCGGA TCCTTATTGTTTTCTTAAATCATTTAAAATAG
mvaS-F CCAGAGCTCAGGAGGTAAAAAAACATGACAATTGGGATTGATAAAATTA
mvaS-R CAACTGCAGTTAGTTTCGATAAGAGCGAACG