Skip to main content

Table 4 Primers used in this study

From: Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci

Primer Application Sequence (5′-3′)
JSP10 Amplification of arsB fragment (PmeI) GGCGCAGCTGTTTAAAC GTCCTGACCATCGTATTGG
JSP11 Amplification of arsB fragment (PmeI) GGGTCAGCTGTTTAAAC GTCCCAAATCGCAGCCAAT
JSP22 Screening oligo for KIKO vector inserts TTCTGCGAAGTGATCTTCCG
JSP55 Amplification of lacZ fragment GCGAGTTTAAAC CATTTTCCGTGACGTCTCGT
JSP56 Amplification of lacZ fragment (PmeI) GCGAGTTTAAAC AAGACTGTTACCCATCGCGT
JSP57 Amplification of rbsAR fragment (PmeI) GCGAGTTTAAAC CAAGCGGCATTGTGTATATC
JSP58 Amplification of rbsAR fragment (PmeI) GCGAGTTTAAAC CCCAGTTCATCTTTCGGTTG
JSP64 Amplification of R6K ori and bla (PvuII) TAGGCAGCTGG GAGGATATTCAAATGGACC
JSP65 Amplification of R6K ori and bla (PvuII) CCCCCAGCTGG ATGCAGGTGGCACTTTTCG
JSP123 Confirmation of arsB genomic insertion CAACCTGGCTCGACAAAACT
JSP124 Confirmation of arsB genomic insertion GTGTCACAAACAGCACAGGC
JSP125 Confirmation of rbsAR genomic insertion CCGAACTGATGAAAGTGCTC
JSP126 Confirmation of rbsAR genomic insertion GCGTAAATCTAAGCCGAACC
JSP129 Confirmation of lacZ genomic insertion GTCTGAATTTGACCTGAGCG
JSP130 Confirmation of lacZ genomic insertion TCATACAGAACTGGCGATCG
JSP148 Amplification of xynA (PstI) AGGACTGCAG CGGAGCTTATCGACTGCACG
JSP149 Amplification of xynA (SalI) AAACGCTGAC TTAACGAGGAGCGGCAGAGG
cscB_F2 Screening oligo for cscAKB insertion ATGGCACTGAATATTCCATTCAGA
KO Test Confirmation of insertion junction at Cm end GGAGTGAATACCACGACGAT
  1. Restriction enzyme sites included in primers are underlined, and the enzyme name is listed in the Application column.