Skip to main content

Table 2 List of primers used on this study

From: Metabolic engineering of Kluyveromyces lactis for L-ascorbic acid (vitamin C) biosynthesis

Name Sequence Restriction site
GME-F 5’CTCGAG ATGGGAACTACCAATGGAACAG3’ XhoI
GME-RFlag 5’CCCGGCGGCCGTCA CTTGTCATCGTCATCCTTGTAATCCTCTTTTCCATCAGCCGCG3’ NotI
VTC2-F 5’GCGGCCGC ATGTTGAAAATCAAAAGAGTTCCGACC3’ NotI
VTC2-RFlag 5’AGGCCTTCA CTTGTCATCGTCATCCTTGTAATCCTGAAGGACAAGGCACTCGGCGGC3’ StuI
VTC4-F 5’CTCGAG ATGGCGGACAATGATTCTCTAG3’ XhoI
VTC4-RFlag 5’AGGCCTTCA CTTGTCATCGTCATCCTTGTAATCTGCCCCTGTAAGCCGC3’ StuI
VT4-F 5’CGACTCGGTACC ATGGCGGACAATGATTCTCTAG3’ KpnI
VT4-R 5’CGACTCGAATTCTCA CTTGTCATCGTCATCCTTG3’ EcoRI
hisG I – F 5’TGTACA CCAGTGGTGCATGAACGC3’ BsrGI
hisG I – R 5’ACATGT CTAGGGATAACAGGGTAATATAGACATGG3’ BsrGI
hisG II – F 5’CGACTCCCCGGG CCAGTGGTGCATGAACGC3’ XmaI/SmaI
hisG II – R 5’CGACTCCTGCAG CTAGGGATAACAGGGTAATATAGACATGG3’ PstI
KanMX-F 5’CGACTCTGTACA CTGAAGCTTCGTACGCTGCA3’ BsrGI
KanMX-R 5’CGACTCCCCGGG ATCACCTAATAACTTCGTATAGCATACATTATAC3’ SmaI
GPDADH1-F 5’CGACTCCATATG GCGGCCGC GTCGAAACTAAGTTCTTGGTGTTTTAAAACT3’ NdeI /NotI
GPDADH1-R 5’CGACTCGACGTC AAGCTT GGCATGCGAAGGAAAATGAGA3’ AatII / HindIII
KlACT1-F 5’ATGGATTCTGAGGTCGCTGC3’  
KlACT1-R 5’TTAGAAACACTTCAAGTGAACGATGG3’  
P1 5’ACACACGTAAACGCGCTCGGT3’  
P2 5’ATCATCCTTGTCAGCGAAAGC3’  
P3 5’ACCTGAAGATAGAGCTTCTAA3’  
P4 5’GGTACCCCTAGGAGATCTAGCTC3’  
  1. Underlined are shown the Flag Tag sequence.
  2. In bold are represented the restriction site.
  3. In grey, the stop codon.