Skip to main content

Table 3 E. coli strains, plasmids and primers used in this study

From: Homofermentative production of optically pure L-lactic acid from xylose by genetically engineered Escherichia coli B

Strains Relevant characteristics Sources
SZ470 E. coli B, ΔfrdBC ΔldhA ΔackA ΔpflB ΔpdhR ::pflBp6-acEF-lpd ΔmgsA [15]
SZ85 E. coli W3110, focA-pflB frdBC adhE ackA ldhA::ldhL [17]
WL202 SZ470, adhE, lost anaerobic growth This study
WL203 WL202, ldhA::ldhL, regained anaerobic growth This study
WL204 WL203, metabolically evolved in xylose with improved anaerobic growth This study
Plasmid   
pKD4 FRT-kan-FRT cassette [16]
pKD46 bla, red recombinase, temperature-dependent replication [16]
pFT-A bla, flp, temperature-dependent replication [20]
Primers   
Clone ldhL-P1 CCTATTATTTATGGCGGTGTCGTTT This study
Clone ldhL-P2 CAGTTCGCTGACTGTAAGTTGTTGC This study
Delete adhE-P1 ATGGCTGTTACTAATGTCGCTGAACTTAACGCAC This study
TCGTAGAGCGTGTGTAGGCTGGAGATGCTTC1)
Delete adhE-P2 TTAAGCGGATTTTTTCGCTTTTTTCTCAGCTTTAG This study
CCGGAGCAGCCATATGAATATCCTCCTTAG1)
Verify adhE-P1 TGATGAAGGCTAATGCTG This study
Verify adhE-P2 CTTACGCCACCTGGAAGT This study
Verify insertion ldhL-P1 GGTTCTAGTTACGCATTCG This study
Verify insertion ldhL-P2 CTTCTTCTTTTCGTCATCG This study
  1. 1. The bold sequence is homologous to the flanked sequence of the FRT-kan-FRT cassette in pKD4.