Skip to main content

Table 1 PCR primers used in this study

From: Starmerella bombicola influences the metabolism of Saccharomyces cerevisiae at pyruvate decarboxylase and alcohol dehydrogenase level during mixed wine fermentation

Gene Sequence (5'-3') Amplicon length
(bp)
Primer efficiency
ADH1 ATCCAACTGTCCTCACGCTGACTT 104 1.01
  TACCTTGAGGAATGTGAGCGGCTT   
PDC1 TGTCGAATTCCACTCCGACCACAT 114 1.00
  TAACCCTTAGCGGCGTCAGCAATA   
TAF10 GCAGCTATTGCAAGGACAGCAACA 142 1.08
  ATTGAGCCCGTATTCAGCAACAGC