Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 6 Primers used in this study

From: One-step generation of error-prone PCR libraries using Gateway® technology

Name Sequence Purpose
XhoI-att R1
(primer 1)
GGGGCTCGAGTACAAGTTTGTACAAAAAAGCTGAA pNGG construction (Gateway® cassette 5' halve)
(primer 2)
(primer 3)
BamHI-att R2
(primer 4)
T7prom TAATACGACTCACTATAGG Sub-cloning screening