Skip to main content

Advertisement

Table 6 Primers used in this study

From: One-step generation of error-prone PCR libraries using Gateway® technology

Name Sequence Purpose
Nco1-MeV.XD GGGGCCATGGGCGCATCACGCAGTGTAATCCGCTCC XD PCR amplification
MeV.XD-AatII GGGGGACGTCGACTTCATTATTATCTTCACCAGCAT  
NTAILF GGGGACAAGTTTGTACAAAAAAGCAGGCTCTACTACTGAGGACAAGATCAGTAGA NTAIL PCR amplification
NTAILR AGCTTTCTTGTACAAAGTGGTGGATCCCCCC  
StopNtail GGGGACAAGTTTGTACAAAAAAGCAGGCTCTTAATAAACTACTGAGGACAAGATCAGTAGA StopNtail PCR amplification
XhoI-att R1
(primer 1)
GGGGCTCGAGTACAAGTTTGTACAAAAAAGCTGAA pNGG construction (Gateway® cassette 5' halve)
BamHI-mut-R
(primer 2)
TCTGGCTTTTAGTAAGCCGGAACCTCTAGATTACGCCCCGCCCTG  
BamHI-mut-F
(primer 3)
CAGGGCGGGGCGTAATCTAGAGGTTCCGGCTTACTAAAAGCCAGA pNGG construction (Gateway® cassette 3' halve)
BamHI-att R2
(primer 4)
GGGGGGATCCACCACTTTGTACAAGAAAGCT  
p17O/ISal1F GGGGGTCGACGCAGGAATCTCGGAAGAACAAGGC PCR construction of pDEST17O/I-idNTAIL
p17O/ISal1R GGGGGTCGACCGTGTAGAAATGATACTTGGGC  
T7prom TAATACGACTCACTATAGG Sub-cloning screening
att B2 CCACTTTGTACAAGAAAGCTGGGT  
att L1 TCGCGTTAACGCTAGCATGGATCTC epPCR
att L2 GTAACATCAGAGATTTTGAGACAC