Skip to main content

Table 2 Oligonucleotides used in this study

From: An internal deletion in MTH1 enables growth on glucose of pyruvate-decarboxylase negative, non-fermentative Saccharomyces cerevisiae

name confirmation of strain sequence (5'- > 3')
primers for cloning  
MTH1BamHI GCGATCGCGGATCCTTGAGGAGGTAGGGAACATC
MTH1HindIII CTGACGCCAAGCTTAAACGGCGACTGGTGGTAAG
URA3fw   GCTGCTACTCATCCTAGTCC
URA3rv   CTTTAGCGGCTTAACTGTGC
MTH1fw   CACCATGTTTGTTTCACCACCACCAGCAACTTCG
MTH1rv   TCAGGATACTGAATCCGGCTGCCAATCCA
primers for diagnostic PCR
MTH1fw IMI073, IMI076 CACCATGTTTGTTTCACCACCACCAGCAACTTCG
MTH1rv IMI073, IMI076 TCAGGATACTGAATCCGGCTGCCAATCCA
m13fw IMI073, IMI076, IMZ103, IMZ104 GTAAAACGACGGCCAG
m132rv IMI073, IMI076, IMZ103, IMZ104 GGAAACAGCTATGACCATG
URA3-A IMI078, IMI082, IMI083 TGCATGAGTCTCAGCTCTAC
URA3-B IMI078, IMI082, IMI083 CCAAGGGTAGAGATCCTAAG