Skip to main content

Advertisement

Table 3 Primers used for cassettes and vector construction

From: A novel system for stable, high-level expression from the T7 promoter

Primer name Sequence (5′ → 3′)
SalINotI 5'Kan GGGGTCGACGCGGCCGCAAGGGGTGTTATGAGCCA
HindIII 3'Kan AAAAGCTTAGAAAAACTCATCGAGCA
Tryp1 TCGACCTAAGCGGCCGCTAATCCCACAGCCGCCAGTTC
Tryp2 CGCTGGCGGCATTTT
Tryp3 GCGGAACTGGCGGCTGTGGGATTAGCGGCCGCTTAGG
Tryp4 GGCCAAAATGCCGCCA
NdeI 5'E2 GAGGGCATATGGCACGTCTAGCCTGCAAGGAAGAT
XhoI 3'E2 AAAAGCTTCTCGAGTTAGTAGTGTGGGAGTCCGTCAG
NdeI 5'PA4D GGGGATTCATATGAAACGTTTTCATTATGATCGCAATAAC
SalI 3'PA4D AAAAGCTTCTCGAGTTATCCTATCTCATAGCCTTTTTTAG
HindIII 3'PA4D AAAAGCTTATCCTATCTCATAGCCTTTTTTAG