Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Expanding the molecular toolbox for Lactococcus lactis: construction of an inducible thioredoxin gene fusion expression system

Primer Sequence (5'-3') Comments
pTX48-F AGCCCATGG GCGATAAAATTATTCACCTGACT Forward primer of trxA
pTX48-R AGCCTGCAGGATCC CTTGTCGTCGTCGTC ACCAGAAGAATGATGATGATGATGGTG CATATGGCCAGAAC Reverse primer of trxA flanked by an enterokinase cleavage site and a His-tag
pTX49-R AGCCTGCAGGATCC CATATGGCCAGAACCAGAAC Reverse primer of trxA
UAL-F AGCAGCCATGG CAGAACATTTTATAAC Forward primer of bppU for pNZ8048
UAL-R AGCAGCACTAGT TTAGTGATGGTGATGGTGATG ATTCCGATAAAGTTTTACAATC Reverse primer of bppL for pNZ8048
UALX-F AGCAGCGGATCC ATGACAGAACATTTTATAAC Forward primer of bppU for pTX8048
UALX-R AGCAGCACTAGT TTAATTCCGATAAAGTTTTACAATC Reverse primer of bppL for pTX8048
orf40-F AGCAGCCCATGG GGCGGCTACTAAGTCGCCACTTGCATAAAT Forward primer of orf40 for pNZ8048
orf40-R AGCAGCACTAGT TTAGTGATGGTGATGGTGATG TAAGTGATAGCCATAAGCAA Reverse primer of orf40 for pNZ8048
orf40X-F AGCAGCGGATCC ATGGGGCGGCTACTAAGTCGCCACTTGCATAAAT Forward primer of orf40 for pTX8048
orf40X-R AGCAGCACTAGT TTATAAGTGATAGCCATAAGCAA Reverse primer of orf40 for pTX8048
0140N-F TGCATCCCATGG ATCATCACCATCACCATCACCATCAC CATCACAGCCGGATTCTCAAGGAC Forward primer of bbr_0140 for pNZ8048
0140N-R TGCGCATCTAGA TTATGCGATGTAGCTTTC Reverse primer of orf40 for pNZ8048
0140C-F AATTAACCATGG GCCGGATTCTCAAGGACAAGC Forward primer of bbr_0140 for pNZ8048
0140C-R TGCCGTTCTAGA TTAGTGATGGTGATGGTGATGGTG ATGGTGATGTGCGATGTAGCTTTCGATGTGTAG Reverse primer of bbr_0140 for pNZ8048
0140X-
F
GACAAGGGATCC ATGAGCCGGATTCTCAAG Forward primer of bbr_0140 for pTX8048
0140X-R AGCTCTCTAGA TTATGCGATGTAGCTTTC Reverse primer of bbr_0140 for pTX8048
  1. In italic font, are indicated the sequencer encoding enterokinase cleavage site. In bold font, are indicated the polyhistidine tag-encoding sequence. The restriction sites are underlined.