Skip to main content

Advertisement

Table 2 Strains, plasmids and primers used in this study

From: Functional identification in Lactobacillus reuteri of a PocR-like transcription factor regulating glycerol utilization and vitamin B12 synthesis

Materials Relevant features Source or reference
Strains   
L. reuteri JCM1112 Type strain, synonymous to ATCC 23272, DSM 20016 and F275. Human isolate. Japanese Collection of Microorganisms (Riken, Japan)
L. reuteri ATCC PTA 6475 Synonymous to MM4-1A. Finnish mother's milk isolate. Biogaia AB (Stockholm, Sweden)
6475::pocR EmR, pocR insertion mutant derivative of L. reuteri ATCC PTA 6475 This study
Lc. lactis NZ9000 MG1363 pepN:nisRK, cloning host. NIZO culture collection (Ede, The Netherlands)
L. delbrueckii NIZO235 L. delbrueckii subsp. lactis ATCC 7830. Vitamin B12 assay indicator strain. NIZO culture collection (Ede, The Netherlands)
Plasmids   
pCR®2.1 Used in routine cloning and to construct pJKS100 Invitrogen (Carlsbad, CA)
pLEM5 L. reuteri replication origin used to construct pJKS100 [28]
pNZ7021 CmR, pNZ8148 derivative with the nisin promoter replaced by the pepN promoter [23]
pNZ7748 CmR, pNZ7021 derivative harboring lreu_1750 downstream of the pepN promoter. This study
pVE6007 CmR, repA-positive temperature-sensitive derivative of pWV01 [27]
pORI28 EmR, repA-negative derivative of pWV01 [35]
pORIpocR EmR, pORI28 derivative harboring internal fragment of gene encoding putative PocR This study
pJKS100 CmR, E. coli-L. reuteri shuttle vector This study
pJKS101 CmR, pJKS100 derivative expressing 6475 pocR gene under control of its natural promoter This study
Primers 5' - 3' Application
P180 AAAAGGTACC GTAGGCGAAATTCAAATGTACG Amplification of lreu_1750 and addition of Kpn I site
P181 GAATAAATAAGAGGCTGGGCAC Amplification of lreu_1750
P182 ATGAACTCTATTCAGGAATTG Control of pNZ7748
LR0062F-BHI TGACGGATCC TAA CACAAGCATTACCGGAGCAATTG Amplification of internal fragment of putative pocR, addition of Bam HI site and translational stop codon
LR0062R-ERI TGACGAATTC GCGTCTGATTCTATATGTGATTC Amplification of internal fragment of putative pocR and addition of Eco RI site
LR0062 FL F CGCTTTATCCTCAATTTGTTACG Amplification of wild-type pocR gene and natural promoter
LR0062 FL R GCTTTTACCATTGCATCAGCAG Amplification of wild-type pocR gene and natural promoter