Functional identification in Lactobacillus reuteri of a PocR-like transcription factor regulating glycerol utilization and vitamin B 12 synthesis

Filipe Santos; Jennifer K Spinler; Delphine MA Saulnier; Douwe Molenaar; Bas Teusink; Willem M de Vos; James Versalovic; Jeroen Hugenholtz

doi:10.1186/1475-2859-10-55

Table 2 Strains, plasmids and primers used in this study

From: Functional identification in Lactobacillus reuteri of a PocR-like transcription factor regulating glycerol utilization and vitamin B₁₂ synthesis

Materials	Relevant features	Source or reference
*Strains*
L. reuteri JCM1112	Type strain, synonymous to ATCC 23272, DSM 20016 and F275. Human isolate.	Japanese Collection of Microorganisms (Riken, Japan)
L. reuteri ATCC PTA 6475	Synonymous to MM4-1A. Finnish mother's milk isolate.	Biogaia AB (Stockholm, Sweden)
6475::pocR	Em^R, pocR insertion mutant derivative of L. reuteri ATCC PTA 6475	This study
Lc. lactis NZ9000	MG1363 pepN:nisRK, cloning host.	NIZO culture collection (Ede, The Netherlands)
L. delbrueckii NIZO235	L. delbrueckii subsp. lactis ATCC 7830. Vitamin B₁₂ assay indicator strain.	NIZO culture collection (Ede, The Netherlands)
*Plasmids*
pCR^®2.1	Used in routine cloning and to construct pJKS100	Invitrogen (Carlsbad, CA)
pLEM5	L. reuteri replication origin used to construct pJKS100	[28]
pNZ7021	Cm^R, pNZ8148 derivative with the nisin promoter replaced by the pepN promoter	[23]
pNZ7748	Cm^R, pNZ7021 derivative harboring lreu_1750 downstream of the pepN promoter.	This study
pVE6007	Cm^R, repA-positive temperature-sensitive derivative of pWV01	[27]
pORI28	Em^R, repA-negative derivative of pWV01	[35]
pORIpocR	Em^R, pORI28 derivative harboring internal fragment of gene encoding putative PocR	This study
pJKS100	Cm^R, E. coli-L. reuteri shuttle vector	This study
pJKS101	Cm^R, pJKS100 derivative expressing 6475 pocR gene under control of its natural promoter	This study
*Primers*	*5' - 3'*	*Application*
P180	AAAAGGTACC GTAGGCGAAATTCAAATGTACG	Amplification of lreu_1750 and addition of Kpn I site
P181	GAATAAATAAGAGGCTGGGCAC	Amplification of lreu_1750
P182	ATGAACTCTATTCAGGAATTG	Control of pNZ7748
LR0062F-BHI	TGACGGATCC TAA CACAAGCATTACCGGAGCAATTG	Amplification of internal fragment of putative pocR, addition of Bam HI site and translational stop codon
LR0062R-ERI	TGACGAATTC GCGTCTGATTCTATATGTGATTC	Amplification of internal fragment of putative pocR and addition of Eco RI site
LR0062 FL F	CGCTTTATCCTCAATTTGTTACG	Amplification of wild-type pocR gene and natural promoter
LR0062 FL R	GCTTTTACCATTGCATCAGCAG	Amplification of wild-type pocR gene and natural promoter

Back to article page