Skip to main content

Advertisement

Table 4 Nucleotide sequences of primers.

From: Heterologous overexpression of Glomerella cingulata FAD-dependent glucose dehydrogenase in Escherichia coli and Pichia pastoris

Primer name Sequence (from 5' to 3')
GC-GDHnde Ifw1 TATCATATG AAGAACCTCATTCCTC
GC-GDHnde Ifw2 TATCATATG CCAGGTTCTGCCCCCAGGG
GC-GDHnde Ifw3 TATCATATG ACGGCATACGACTATATTGTC
GC-GDHnot Irv ATACGGCCG TCATTAAGCAGCAGCCTTGATCAGAT
GC-GDH-Bst BI+SS TATTTCGAA ATGAAGAACCTCATTCCTCTTTCC
GC-seq-rv1 AGGTAGAAGCACCACCAGAGG