Table 2 Oligonucleotides used in this work
From: New approaches to achieve high level enzyme production in Streptomyces lividans
Name | Sequence 5′–3′ | Use |
|---|---|---|
LS-001 | TTTTTTGAATTCTGTGCGGCTGCCCTTCCGCC | Forward oligonucleotide for cloning the glpQp. The sequence recognized by EcoRI is in italics |
LS-002 | TTTTTTCATATGCGTACTCCTCGCGTCGAACG | Reverse oligonucleotide for cloning the glpQp. The sequence recognized by NdeI is in italics |
LS-Amy | TTTTTTCATATGGCCCGCAGACTCGCCACC | Forward oligonucleotide to introduce the amylase signal peptide. The sequence recognized by NdeI is in italics |
LS-003 | TTTTTTCGCCGGCGGCAGCGGCGGGTGTG | Reverse oligonucleotide to introduce the amylase signal peptide. The sequence recognized by MreI is in italics |
LS-004 | TTTTTTCGCCGGCGGGCGGGGCGGCAGCGGC | Reverse oligonucleotide to introduce the amylase signal peptide with three additional amino acids. The sequence recognized by MreI is in italics |
LS-023 | TTTTTTGAATTCGGTACCAGCCCGACCCGAGC | Forward oligonucleotide for cloning the ermE*p. The sequence recognized by EcoRI is in italics |
LS-024 | TTTTTTCATATGACCAACCGGCACGATTGTGCC | Reverse oligonucleotide for cloning the ermE*p. The sequence recognized by NdeI is in italics |
LS-026 | TTTTTTGAATTCGGGGATGACCACCGCGGGAG | Forward oligonucleotide for cloning the vsip. The sequence recognized by EcoRI is in italics |
LS-027 | TTTTTTGATATCGGTGAACTCTCCTTCGATCGATG | Reverse oligonucleotide for cloning the vsip. The sequence recognized by EcoRV is in italics |
RS-003 | TTTTTTGAATTCGGGCTTCTCCCTCTTCCGCGGG | Forward oligonucleotide for cloning the xylp. The sequence recognized by EcoRI is in italics |
RS-004 | TTTTTTCATATGCCGCGGCTCCTCACTCGCTGC | Reverse oligonucleotide for cloning the xylp. The sequence recognized by NdeI is in italics |
LS-celF | TTTTTTGAATTCGGCCGGCCGCTCCCGTCTGGC | Forward oligonucleotide for cloning the celAp. The sequence recognized by EcoRI is in italics |
LS-celR | TTTTTTCATATGCAGTACCTCGATTTCAGAGGA | Reverse oligonucleotide for cloning the celAp. The sequence recognized by NdeI is in italics |
MRG11 | TTTTTTCATATGGCCCGCAGACTCCGCACC | Forward oligonucleotide for cloning amylase ORF. The sequence recognized by NdeI is in italics |
MRG12 | TTTTTTCTCGAGGCCGCGCCAGGTGTCGTTGAG | Reverse oligonucleotide for cloning amylase ORF. The sequence recognized by XhoI is in italics |
4215UpF | GCGGAATTCAGCTGCTCAAGGACGCCGGC | Forward oligonucleotide for the cloning upstream flank of XlnR. The sequence recognized by EcoRI is in italics |
4215UpR | GCGGGATCCCATCCCGTGGGCCTCCTCTCC | Reverse oligonucleotide for the cloning upstream flank of XlnR. The sequence recognized by BamHI is in italics |
4215DwF | GCGTCTAGAGTAACTCGAGCGGTCTCGCCC | Forward oligonucleotide for the cloning downstream flank of XlnR. The sequence recognized by XbaI is in italics |
4215DwR | CGCAAGCTTCCGCATCTGCTGGAGCCGG | Reverse oligonucleotide for the cloning downstream flank of XlnR. The sequence recognized by HindIII is in italics |
7232UpF | GCGGAATTCGTGAGGTGTGTGGTCATGAGCC | Forward oligonucleotide for the cloning of upstream flank of BxlR. The sequence recognized by EcoRI is in italics |
7232UpR | CGCTCTAGACCGGGCGCCCACCTCAAC | Reverse oligonucleotide for the cloning upstream flank of BxlR. The sequence recognized by XbaI is in italics |
7232DwF | GCGTCTAGAGGCTCCTACCGGCCGGGC | Forward oligonucleotide for the cloning downstream flank of BxlR. The sequence recognized by XbaI is in italics |
7232DwR | CGCAAGCTTGTGCCGCGGCCGGAGCCG | Reverse oligonucleotide for the cloning downstream flank of BxlR. The sequence recognized by HindIII is in italics |