Table 1 Primers used in this study.
name | sequence (5'-3') | purpose |
|---|---|---|
ORFstart | cgggatccatgctattgctgctatttc | cloning ORF238 |
ORFstop | cggaattctcataacaaattcaaaatcttcag | cloning ORF238 |
CTXVP2 | cctcctggaactggttga | amplifying/sequencing ctxvp60 |
CTXVP3 | ggaggatctacttctgct | amplifying/sequencing ctxvp60 |
CVek3 | gcctggttgtacgcctgaa | amplifying/sequencing ctxvp60 |
T7 | taatacgactcactataggg | amplifying/sequencing ctxvp60 |
chi3 | gtgagtttcaccagttttga | amplifying/sequencing ctxvp60 |
vpf1 | cctgggtcctattccatcagtagtagttaat | constructing ctxvp60 frame-shift |
vpf2 | tgatggaataggacccaggagttgttgct | constructing ctxvp60 frame-shift |
IS1-1 | tcgctgtcgttctca | IS1-specific PCR |
IS1-2 | aagccactggagcac | IS1-specific PCR |
IS2-1 | tcgcaggcataccatcaa | IS2-specific PCR |
IS2-2 | cagacgggttaacggca | IS2-specific PCR |
IS3-1 | agcggctggtatacgtggt | IS3-specific PCR |
IS3-2 | tcatgcgtggcgacattga | IS3-specific PCR |
IS5-1 | gacagttcggcttcgtga | IS5-specific PCR |
IS5-2 | gctcgatgacttccacca | IS5-specific PCR |
groL1 | atggcgtgggtgaagaag | amplification of control groL |
groL2 | caatctgctgacggatctga | amplification of control groL |