Antisense RNA based down-regulation of RNaseE in E.coli

Table 3 PCR primers used for amplification of antisense fragments and insertion of EcoRV restriction site into pP4Hcyt. The annealing temperature for all primers was 55°C

Primer designation	Sequence 5'-3'¹	Restriction site
antisense1 fw	ctgac tctaga CGTTACTTTGCCCGCAGCTTAG	Xba I
antisense1 rv	gtgct agatct GGCAACGCGCAAC TCTTCCTG	Bgl II
antisense2 fw	ccaag tctaga GAATGTTAATCAACGCAACTCAGC	Xba I
antisense2 rv	cgacc agatct CAGCTTCCAGACTCGGTTCAATG	Bgl II
antisense3 fw	gtagg tctaga GTTGATTACGGCGCTGAACGTC	Xba I
antisense3 rv	ggacc agatct ACTTCCTGACCTTCACGCAACAC	Bgl II
antisense4 fw	cacca tctaga GCGGCCTGATTGTTATCGACTTC	Xba I
antisense4 rv	gtccg agatct TGATTTGAATACGCGCACGGTCC	Bgl II
antisense5 fw	caggt tctaga CGAAGGCGCTGAATGTTGAAGAG	Xba I
antisense5 rv	ccagt agatct GCTCGTAACGCACTTTCTGATTG	Bgl II
antisense6 fw	ggagc tctaga AGTCGTCAATGTAAGAATAATG	Xba I
antisense6 rv	ggagc agatct CGATATCCAGGTCATACAG	Bgl II
antisense7 fw	cgagc tctaga AGTCGTCAATGTAAGAATAATG	Xba I
antisense7 rv	gtgct agatct GGCAACGCGCAACTCTTCCTG	Bgl II

¹ Sequence homologies are shown in capital letters, target sequences for restriction endonucleases are underlined, bases for protection of primer ends are italicised.

ISSN: 1475-2859