Materials | Relevant features | Source or reference |
---|---|---|
Strains | Â | Â |
L. reuteri JCM1112 | Type strain, synonymous to ATCC 23272, DSM 20016 and F275. Human isolate. | Japanese Collection of Microorganisms (Riken, Japan) |
L. reuteri ATCC PTA 6475 | Synonymous to MM4-1A. Finnish mother's milk isolate. | Biogaia AB (Stockholm, Sweden) |
6475::pocR | EmR, pocR insertion mutant derivative of L. reuteri ATCC PTA 6475 | This study |
Lc. lactis NZ9000 | MG1363 pepN:nisRK, cloning host. | NIZO culture collection (Ede, The Netherlands) |
L. delbrueckii NIZO235 | L. delbrueckii subsp. lactis ATCC 7830. Vitamin B12 assay indicator strain. | NIZO culture collection (Ede, The Netherlands) |
Plasmids | Â | Â |
pCR®2.1 | Used in routine cloning and to construct pJKS100 | Invitrogen (Carlsbad, CA) |
pLEM5 | L. reuteri replication origin used to construct pJKS100 | [28] |
pNZ7021 | CmR, pNZ8148 derivative with the nisin promoter replaced by the pepN promoter | [23] |
pNZ7748 | CmR, pNZ7021 derivative harboring lreu_1750 downstream of the pepN promoter. | This study |
pVE6007 | CmR, repA-positive temperature-sensitive derivative of pWV01 | [27] |
pORI28 | EmR, repA-negative derivative of pWV01 | [35] |
pORIpocR | EmR, pORI28 derivative harboring internal fragment of gene encoding putative PocR | This study |
pJKS100 | CmR, E. coli-L. reuteri shuttle vector | This study |
pJKS101 | CmR, pJKS100 derivative expressing 6475 pocR gene under control of its natural promoter | This study |
Primers | 5' - 3' | Application |
P180 | AAAAGGTACC GTAGGCGAAATTCAAATGTACG | Amplification of lreu_1750 and addition of Kpn I site |
P181 | GAATAAATAAGAGGCTGGGCAC | Amplification of lreu_1750 |
P182 | ATGAACTCTATTCAGGAATTG | Control of pNZ7748 |
LR0062F-BHI | TGACGGATCC TAA CACAAGCATTACCGGAGCAATTG | Amplification of internal fragment of putative pocR, addition of Bam HI site and translational stop codon |
LR0062R-ERI | TGACGAATTC GCGTCTGATTCTATATGTGATTC | Amplification of internal fragment of putative pocR and addition of Eco RI site |
LR0062 FL F | CGCTTTATCCTCAATTTGTTACG | Amplification of wild-type pocR gene and natural promoter |
LR0062 FL R | GCTTTTACCATTGCATCAGCAG | Amplification of wild-type pocR gene and natural promoter |