Skip to main content

Table 6 Oligonucleotides used in this study

From: Production of indole by Corynebacterium glutamicum microbial cell factories for flavor and fragrance applications

Oligonucleotide Sequence 5′-> 3′
EctnaB_fw GGTCTCTGCAACTAGGAGGATTACAAAATGACTGATCAAGCTGAAAAA
EctnaB_rv GGTCTCAATACTTAGCCAAATTTAGGTAACACG
CgaroP_fw GGTCTCTGCAACTAGGAGGATTACAAAATGGCTAAATCTAATGAAGGG
CgaroP_rv GGTCTCAATACTCAGTTCAAGTCGGAAGGG
EcridA_fw cctgcaggtcgactctagagTATTAATAAGGAGGTAACATGAGCAAAACTATCGCGAC
EcridA_rv attcgagctcggtacccgggTTAGCGACGAACAGCGATC
EcyjgH_fw cctgcaggtcgactctagagATCATAAAGGAGGTATATTTATGGTAGAAAGAACCGCTG
EcyjgH_rv attcgagctcggtacccgggTTACTGCTCAGGGATGCG
PretnaA_artRBS_fw gaGGTCTCTCAGATGGCCGTAGCTTAAGGAGGTATAGTATGGCAAAGCGCATCGTTG
PretnaA_rv tccGGTCTCATTGCTTACTTGATTGGCTTCAGACG